Skip to Content
Merck
CN

Custom dPCR Primers &
Probes

for the Roche Digital LightCycler® System


In partnership with Roche, we are pleased to offer custom primers, standard (3’-quenched) probes, internal-quenched probes, and dual-quenched (internal & 3’-quenched) probes for the Digital LightCycler® System.

Digital PCR (dPCR) is an end-point PCR method that is used for absolute quantification and for analysis of minority sequences against a background of similar majority sequences. The Roche Digital LightCycler® System System (Figure 1) supports cell-free DNA / oncology, gene expression / absolute quantification, and copy number variation / NIPT applications with high sensitivity (20,000 partitions), universal (28,000 partitions), and high resolution (100,000 partitions) settings, respectively.

From left to right: analyzer and partitioning engine. Highlights include: six optical channel analyzer to enable high multiplexing; three consumables configurations for different clinical applications; generic 5X DNA master mix optimized for high specificity and signal separation; generic 5X RNA master mix optimized for robust and efficient RT activity; simple workflow with sample tracking and automated data analysis; maximum 96 samples per run (1-12 plates); and, a run time of 2-4 hours

Figure 1. From left to right: analyzer and partitioning engine. Highlights include: six optical channel analyzer to enable high multiplexing; three consumables configurations for different clinical applications; generic 5X DNA master mix optimized for high specificity and signal separation; generic 5X RNA master mix optimized for robust and efficient RT activity; simple workflow with sample tracking and automated data analysis; maximum 96 samples per run (1-12 plates); and, a run time of 2-4 hours

As shown below in the performance data, our primers and probes have been extensively tested and found to work well with this digital PCR platform.

Product Benefits

  • Primers
    • Get them your way: wide range of scales, purifications, etc.
    • Improved hybridization specificity with Locked Nucleic Acid
  • Standard Probes
    • Design simplicity for sequence specificity
    • Extensive availability of reporter/quencher combinations
  • Internal-Quenched Probes
    • Design longer probes
    • Extensive availability of reporter/quencher combinations
  • Dual-Quenched Probes
    • Design longer probes
    • Best signal-to-noise ratio
    • Better performance with challenging targets

If you have needs that are different from the other general specifications presented, please send a request to dnaoligos@merckgroup.com

Performance Data

Roche R&D tested standard probe, internal-quenched probe, and dual-quenched probe assays on the Digital LightCycler® System. Parameters were as follows:

  • Human DNA targets (Figures 2 & 3)
    • EIF5B (Intron 1)
      • Amplicon: 112 bp
      • Forward primer: GGCCGATAAATTTTTGGAAATG
      • Reverse primer: GGAGTATCCCCAAAGGCATCT
      • Standard probe: [6FAM]TTCAGCCTTCTCTTCTCATGCAGTTGTCAG[BHQ1]
      • Internal-quenched probe: [6FAM]TTCAGCCTT[BHQ2]CTCTTCTCATGCAGTTGTCAG
      • Dual-quenched probe: [6FAM]TTCAGCCTT[BHQ2]CTCTTCTCATGCAGTTGTCAG[BHQ1]
    • HER2 (Exon 7)
      • Amplicon: 112 bp
      • Forward primer: CTCATCGCTCACAACCAAGT
      • Reverse primer: GGTCTCCATTGTCTAGCACG
      • Standard probe: [HEX]ACCCAGCTCTTTGAGGACAACTATGC[BHQ1]
      • Internal-quenched probe: [HEX]ACCCAGCTC[BHQ2]TTTGAGGACAACTATGC
      • Dual-quenched probe: [HEX]ACCCAGCTC[BHQ2]TTTGAGGACAACTATGC[BHQ1]
    • Experimental Setup
      • Singleplex assays
      • Digital LightCycler® DNA Master Mix
      • High resolution plate
      • HCT-116 gDNA template at ~1 cpp
      • 900 nM / 250 nM & 450 nM / 125 nM primers / probe concentrations
      • Two technical replicates for each condition with one NTC
      • 1D fluorescence scatter plots analysis
  • Human RNA targets (Figure 4)
    • HER2 (Exon 7)
      • Amplicon length, primers, and probes were all identical to the HER2 DNA assay above.
    • R4Q5 [DCK] (Exon 3)
      • Amplicon: 122 bp
      • Forward primer: CTCAGAAAAATGGTGGGAATGTT
      • Reverse primer: GCCATTCAGAGAGGCAAGCT
      •  Standard probe: [Cyanine5]CCTTCCAAACATATGCCTGTCTCAGTCGA[BHQ3]
      • Internal-quenched probe: [Cyanine5]CCTTCCAAA[BHQ2]CATATGCCTGTCTCAGTCGA
      • Dual-quenched probe: [Cyanine5]CCTTCCAAA[BHQ2]CATATGCCTGTCTCAGTCGA[BHQ3]
    • Experimental Setup
      • Singleplex assays
      • Digital LightCycler® RNA Master Mix
      • High resolution plate
      • 50 ng Clontech qPCR Human Reference Total RNA
      • 450 nM / 125 nM primers / probe concentrations
      • Two technical replicates for each condition with one NTC
      • 1D fluorescence scatter plots analysis
1D scatter plots of EIF5B DNA target assays

Figure 2.1D scatter plots of EIF5B DNA target assays. A) 900 nM primers and 250 nM probe. B) 450 nM primers and 125 nM probe. For A and B, from left to right: Control, standard probe assay, internal-quenched probe assay, and dual-quenched probe assay. Only one replicate is shown for each assay.

1D scatter plots of HER2 DNA target assays

Figure 3.1D scatter plots of HER2 DNA target assays. A) 900 nM primers and 250 nM probe. B) 450 nM primers and 125 nM probe. For A and B, from left to right: Control, standard probe assay, internal-quenched probe assay, and dual-quenched probe assay. Only one replicate is shown for each assay.

1D scatter plots of RNA target assays

Figure 4.1D scatter plots of RNA target assays. A) HER2 assay, 450 nM primers and 125 nM probe. B) R4Q5 (DCK) assay, 450 nM primers and 125 nM probe. For A and B, from left to right: Control, standard probe assay, internal-quenched probe assay, and dual-quenched probe assay. Only one replicate is shown for each assay.


Products