Skip to Content
Merck
CN

Skip To

C2014

Sigma-Aldrich

Collagenase from Clostridium histolyticum

0.2 μm filtered, Type V-S, ≥1 FALGPA units/mg solid, ≥125 CDU/mg solid

Synonym(s):

Clostridiopeptidase A

Sign Into View Organizational & Contract Pricing

Select a Size

Change View
20 μG
CN¥2,253.83
50 μG
CN¥4,055.60

About This Item

CAS Number:
EC Number:
EC Number:
MDL number:
UNSPSC Code:
12352204
NACRES:
NA.54

CN¥2,253.83


Estimated to ship onDecember 12, 2025Details


Request a Bulk Order
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Quality Level

sterility

0.2 μm filtered

form

lyophilized powder

specific activity

≥1 FALGPA units/mg solid
≥125 CDU/mg solid

mol wt

68-125 kDa

storage temp.

−20°C

Looking for similar products? Visit Product Comparison Guide

Compare Similar Items

View Full Comparison

Show Differences

1 of 1

This Item
EMU028131EMU035121EMU027681
Ensembl | mouse accession no.

ENSMUSG00000022661

Ensembl | mouse accession no.

ENSMUSG00000026480

Ensembl | mouse accession no.

ENSMUSG00000020647

Ensembl | mouse accession no.

ENSMUSG00000039308

esiRNA cDNA target sequence

ACAGAGCTGGGACTCTGGAACTCAAGCATCACCTTCTGGAACACACACATTGGAGATGGAGGCTGCTACATGTGTCTCTTCAACACGTTTGGTTCTCAGAAGGTCTCAGGAACAGCTTGCCTTACTCTCTATGTACAGCCCATAGTACACCTTCACTACAACTATTTTGAACACCACCTAAACATCACTTGCTCTGCGACTGCCCGTCCAGCCCCTGCCATCACCTGGAAGGGTACTGGGACAGGAATTGAGAATAGTACCGAGAGTCACTTCCATTCAAATGGGACTACATCTGTCACCAGCATCCTCCGGGTCAAAGACCCCAAAACTCAAGTTGGGAAGGAAGTGATCTGCCAGGTTTTATACCTGGGGAATGTGATTGACTACAAGCAGAGTCTGGACAAAGGATTTTGGTTTTCAGTTCCACTGTTGCTAAGCATTGTTTCTCTGGTAATTCTTCTGATCTTGATCTCCATCTTACTATACTGGAAACGTCACCGAAATCAGGAG

esiRNA cDNA target sequence

GCCAGAAGACCTGGAATTTGTGGAAGGAGATGTAATCCTGGTACTGTCACATGTGAATGAAGAATGGCTGGAAGGGGAGTGTAAAGGGAAAGTTGGCATTTTCCCGAAGGCTTTTGTTGAAGGATGTGCAGCCAAGAATTTGGAAGGCATTCCCAGAGAAGTCTAGGATCTACAAAGCTGAAGCAAAGTGTTGTTTTTCCCCTTGCAAGACTTACCCATCTCTGCTGTGCGCTATACAGACACACAAGTTTGGAAATGTGGCCTAACTTACCATTTCCCTATTAAAATTGAACCTGTCACACAGCAATATGACAACTCAGAAGATTTTCTTACAGATGGAGGAGGGGGAGACAAATTTTCTGCAAAGGAAATGAAGGTTTGTGTGTGTGCTGGCTACGTGAATGTACTTAAGAATTCCCAGAGCTGCACACCAATGGGCACACCTTTCTGCTGGGAAAACAG

esiRNA cDNA target sequence

GTTGCCTTAAACCAGGGACAGGCAGGTTCCCAGAGCAGCAATCCCTCTTTAAACCTCAATAATTCTCCTATGGAAGGTACAGGAATTGCCCTCTCACAGTTCATGTCTCCGAGGAGACAAGCTAATTCTGGCTTGGCAACAAGGGCCAGGATGTCAAACAATTCATTTCCTCCAAATATTCCAACATTAAGCTCCCCAGTTGGCATTACTAGTGGTGCCTGTAATAATAATAATCGATCCTATTCAAATATCCCAGTAACATCTTTACAAGGTATGAATGAAGGACCCAATAACTCTGTTGGCTTCTCTGCTGGGTCTCCAGTCCTTCGGCAGATGAGCTCACAGAATTCACCTAGCAGATTAAGTATGCAACCAGCAAAGGCTGAGTCCAAAGACAGCAAAGAGATTGCATCCATTTTAAATGAAATGATTCAGTCCGACAACAGCGACAACAGTGCTAACGAAGGCAAGCCTCTGGACTCAGGAC

esiRNA cDNA target sequence

AATGCCAGCACTGACTTCCTGTTTGAAAAAAGTGCCACCTACTTTGACTCGGAGGTCGTACCACGGCGGGGGGCTGCCCTTCTGCCAAGAGCCAAGATAATCACTGTGCTTATCAACCCTGCTGACAGGGCCTACTCCTGGTACCAGCACCAGCGAGCACATGGAGACCCCATTGCTCTGAACTACACCTTCTACCAAGTGATTTCAGCTTCTTCTCAGGCCCCTCTGCTACTTCGCTCCTTGCAGAACCGTTGTCTTGTTCCTGGCTACTATTCTACCCATCTTCAACGCTGGCTGACTTACTATCCCTCTGGACAGTTGCTGATTATGGATGGGCAGGAGCTTCGTGTCAACCCGGCAGCCTCAATGGAGATCATCCAGAAGTTCCTGGGTATCACCCCCTTTCTGAACTACACGAGGACCCTCAGGTTTGATGAAGATAAAGGATTTTGGTGCCAGG

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Gene Information

mouse ... Cd200(17470)

Gene Information

mouse ... NCF2(17970), Ncf2(17970)

Gene Information

mouse ... NCOA1(17977), Ncoa1(17977)

Gene Information

mouse ... NDST2(17423), Ndst2(17423)

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

NCBI accession no.

NM_010818

NCBI accession no.

NM_010877

NCBI accession no.

NM_010881

NCBI accession no.

NM_010811

Application

Collagenase has been used in the preparation of arterial tissue for the study of Advanced Glycosylation End Products (AGE). The enzyme has also been used along with other proteases for the disaggregation of human tumor, mouse kidney, human brain, lung epithelium and many other tissues. It is also effective in liver and kidney perfusion studies, digestion of pancreas, and isolation of nonparenchymal hepatocytes.

Biochem/physiol Actions

Collagenase is activated by four gram atom calcium per mole enzyme. It is inhibited by ethylene glycol-bis(beta-aminoethyl ether) - N, N, N′,N′-tetraacetic acid, beta-mercaptoethanol, glutathione, thioglycolic acid and 8-hydroxyquinoline.
Effective release of cells from tissue requires the action of both collagenase enzymes and the neutral protease. Collagenase is activated by four gram atom calcium (Ca2+) per mole enzyme. The culture filtrate is thought to contain at least 7 different proteases ranging in molecular weight from 68-130 kDa (pH optimum: 6.3-8.8). The enzyme recognizes the sequence -R-Pro-8-X-Gly-Pro-R-, where X is most often a neutral amino acid.

Preparation Note

Prepared from Type V (C9263)

Analysis Note

Also contains clostripain, nonspecific neutral protease, and tryptic activities.

Other Notes

One collagen digestion unit (CDU) liberates peptides from collagen from bovine achilles tendon equivalent in ninhydrin color to 1.0 μmole of leucine in 5 hours at pH 7.4 at 37 °C in the presence of calcium ions. One FALGPA hydrolysis unit hydrolyzes 1.0 μmole of furylacryloyl-Leu-Gly-Pro-Ala per min at 25°C. One Neutral Protease unit hydrolyzes casein to produce color equivalent to 1.0 μmole of tyrosine per 5 hr at pH 7.5 at 37°C. One Clostripain Unit hydrolyzes 1.0 μmole of BAEE per min at pH 7.6 at 25°C in the presence of DTT.

used together

Product No.
Description
Pricing

Pictograms

Health hazardExclamation mark

Signal Word

Danger

Hazard Statements

Hazard Classifications

Eye Irrit. 2 - Resp. Sens. 1 - Skin Irrit. 2 - STOT SE 3

Target Organs

Respiratory system

Storage Class Code

11 - Combustible Solids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Personal Protective Equipment

dust mask type N95 (US), Eyeshields, Gloves

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

F T D Kaplan
Drugs of today (Barcelona, Spain : 1998), 47(9), 653-667 (2011-10-06)
Collagenase clostridium histolyticum is a novel treatment for Dupuytren's contracture, approved by the U.S. Food and Drug Administration in February 2010. Prior to its availability, surgery was the only treatment for contracture related to this disorder. Dupuytren's disease is a
Drug and therapeutics bulletin, 49(12), 138-141 (2011-12-16)
Dupuytren's contracture is a benign, progressive disabling condition of the hands. Traditionally, surgery (e.g. fasciotomy, fasciectomy, joint fusion and amputation) has been the only effective treatment but it is not an option for every patient. A potential alternative intervention is
Martin Gelbard et al.
The Journal of urology, 187(6), 2268-2274 (2012-04-17)
Collagenase Clostridium histolyticum is an investigational nonsurgical treatment for Peyronie disease. In this phase 2b, double-blind, randomized, placebo controlled study we determined the safety and efficacy of collagenase C. histolyticum and assessed a patient reported outcome questionnaire. A total of
Stephen Coleman et al.
BMC musculoskeletal disorders, 13, 61-61 (2012-05-01)
Dupuytren's contracture (DC) is a progressive fibroproliferative disorder characterized by development of nodules and collagen cords within the palmar fascia of the hand. Collagenase clostridium histolyticum (CCH) is currently approved in adults with DC for the nonsurgical treatment of a
Farhatullah Syed et al.
PloS one, 7(2), e31430-e31430 (2012-03-03)
Dupuytren's disease (DD) is a benign, fibroproliferative disease of the palmar fascia, with excessive extracellular matrix (ECM) deposition and over-production of cytokines and growth factors, resulting in digital fixed flexion contractures limiting hand function and patient quality of life. Surgical

Protocols

To measure collagenase activity, N-(3-[2-Furyl]acryloyl)-Leu-Gly-Pro-Ala is used in a continuous spectrophotometric rate determination at 345 nm. Collagenase hydrolyzes collagen peptide bonds.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service