Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCACTGGTTCCCAGAAAAGCCATGCAAGGGATCGGGTTACCGTTGTATTCGCATCAACCATAAAATGGATCCTCTGATTGGACAGGCAGCACAGCGGATTGGACTGAGCAGTCAGGAGCTGTTCAGGCTTCTCCCAAGTGAACTCACACTCTGGGTTGACCCCTATGAAGTGTCCTACAGAATTGGAGAGGATGGCTCCATCTGTGTGCTGTATGAAGCCTCACCAGCAGGAGGTAGCACTCAAAACAGCACCAACGTGCAAATGGTAGACAGCCGAATCAGCTGTAAGGAGGAACTTCTCTTGGGCAGAACGAGCCCTTCCAAAAACTACAATATGATGACTGTATCAGGTTAAGATATAGTCTGTGGATGGATCATCTGATGATGATGGATAAATTTGATTTTTGCTTTGGGTGGGCTCCTCTTGGGGATGGATTATGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... BTG1(694)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Peng Yin et al.
Cancer chemotherapy and pharmacology, 81(5), 863-872 (2018-03-15)
Nasopharyngeal carcinoma (NPC) is one of the most commonly diagnosed cancers worldwide with significantly high prevalence in Southern China. Chemoprevention of cancer with alkylating agent compounds could potentially reverse, suppress, or prevent cancer progression. Cisplatin (CIS) is an antineoplastic or
Zhen-Zhen Zhang et al.
American journal of physiology. Endocrinology and metabolism, 316(6), E1050-E1060 (2019-03-06)
Diabetic retinopathy (DR) is a serious diabetic complication caused by both environmental and genetic factors. Molecular mechanisms of DR may lead to the discovery of reliable prognostic indicators. The current study aimed to clarify the mechanism of microRNA-183 (miR-183) in
Jeong Sook Kim et al.
International journal of molecular sciences, 20(13) (2019-07-22)
Estrogen affects endometrial cellular proliferation by regulating the expression of the c-myc gene. B-cell translocation gene 1 (BTG1), a translocation partner of the c-myc, is a tumor suppressor gene that promotes apoptosis and negatively regulates cellular proliferation and cell-to-cell adhesion.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU001251-50UG | 04061828442171 |
| EHU001251-20UG | 04061828667413 |