Skip to Content
Merck
CN

EHU004681

MISSION® esiRNA

targeting human KIF4A

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAATTGGCTTGGAAACGAAATTGAGGTTATGGTCAGTACTGAGGAAGCCAAACGCCATCTGAATGACCTCCTTGAAGATAGAAAGATCCTGGCTCAAGATGTGGCTCAACTCAAAGAAAAAAAGGAATCTGGGGAGAATCCACCTCCTAAACTCCGGAGGCGTACATTCTCCCTTACTGAAGTGCGTGGTCAAGTTTCGGAGTCAGAAGATTCTATTACAAAGCAGATTGAAAGCCTAGAGACTGAAATGGAATTCAGGAGTGCTCAGATTGCTGACCTACAGCAGAAGCTGCTGGATGCAGAAAGTGAAGACAGACCAAAACAACGCTGGGAGAATATTGCCACCATTCTGGAAGCCAAGTGTGCCCTGAAATATTTGATTGGAGAGCTGGTCTCCTCCAAAATACAGGTCAGCAAACTTGAAAGCAGCCTGAAACAGAGCAAGACCAGCTGTGCTGACATGCAGAAGATGCTGTTTGAGGAACGAAATCATTTTGCCGAGATAGAGACAGAGTTACAAGCTGAGCTGGTCAGAATGGAGCAACAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KIF4A(24137)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guang-Hua Yang et al.
OncoTargets and therapy, 13, 2667-2676 (2020-04-14)
To evaluate the expression in human clear cell renal cell carcinoma (ccRCC) tissues and explore the effects of kinesin family member 4A (KIF4A) on ccRCC progression. GEPIA was used to evaluate the mRNA levels of KIF4A in human ccRCC tissues
Junda Lin et al.
Medical oncology (Northwood, London, England), 34(1), 9-9 (2016-12-23)
Fucoidan is a complex of polysaccharides showing antitumor and immunomodulation properties. Our previous studies found its regulation to myeloid immune cells, including macrophages. Aberrant infiltration and functions of macrophages are commonly found in oral squamous cell carcinoma (OSCC). In this
Xiaozheng Sun et al.
Thoracic cancer, 12(4), 512-524 (2020-12-23)
In this study, we aimed to explore and clarify the function of KIF4A in esophageal squamous cell carcinoma (ESCC). The microarray data were extracted from the Gene Expression Omnibus (GEO) database. We then used the database for Annotation, Visualization, and
Ping-Fu Hou et al.
Cell death & disease, 9(5), 477-477 (2018-05-01)
Kinesin family member 4A (KIF4A) was found to be implicated in the regulation of chromosome condensation and segregation during mitotic cell division, which is essential for eukaryotic cell proliferation. However, little is known about the role of KIF4A in colorectal
Elena Poser et al.
The Journal of cell biology, 219(2) (2019-12-28)
Aurora kinases create phosphorylation gradients within the spindle during prometaphase and anaphase, thereby locally regulating factors that promote spindle organization, chromosome condensation and movement, and cytokinesis. We show that one such factor is the kinesin KIF4A, which is present along

Related Content

Instructions

Global Trade Item Number

SKUGTIN
EHU004681-20UG04061828669707
EHU004681-50UG04061828444250

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service