Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAATGGCTACGGATCATCACCTACCTTTTCCCAGACGGACAGAGAACATGGTTCAAAAACAAGTGCAAAGGCCCTTTATGAACAAAGGAAGAATTATGCACGGGACAGTGTCAGCAGTGTGTCAGATATATCTCAATACCGTGTTGAACACTTGACTACCTTTGTCCTGGATCGGAAAGATGCTATGATCACTGTTGATGATGGAATAAGGAAATTGAAATTGCTTGATGCCAAGGGCAAAGTGTGGACTCAAGATATGATTCTTCAAGTGGATGACAGAGCTGTGAGCCTGATTGATTTAGAATCAAAGGCAAGTAATGAACTGGAGAATTTTCCTTTAAACACAATCCAGCACTGCCAAGCTGTGATGCATTCATGCAGCTATGATTCAGTTCTTGCACTGGTGTGCAAAGAGCCAACCCAGAACAAGCCAGAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... EPS8(2059)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Jieyun Zhang et al.
Acta biochimica et biophysica Sinica, 52(3), 259-267 (2020-03-10)
Tumor metastasis is the main cause of treatment failure and death in patients with late stage of gastric cancer (GC). Studies showed that microRNAs (miRNAs) are important regulators in the process of tumor metastasis. In this study, we used miRNA
Haruhi Fukuhisa et al.
Journal of human genetics, 64(6), 521-534 (2019-03-13)
Our ongoing analyses identifying dysregulated microRNAs (miRNAs) and their controlled target RNAs have shed light on novel oncogenic pathways in pancreatic ductal adenocarcinoma (PDAC). The PDAC miRNA signature obtained by RNA sequencing showed that both strands of pre-miR-130b (miR-130b-5p, the
Huifang Lu et al.
Molecular medicine reports, 14(6), 4999-5006 (2016-11-15)
Epidermal growth factor receptor pathway substrate 8 (EPS8) is critical in the proliferation, progression and metastasis of solid and hematological types of cancer, and thus constitutes an ideal target for cancer immunotherapy. The present study aimed to identify human leukocyte antigen
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU005981-20UG | 04061828670888 |
| EHU005981-50UG | 04061828445516 |