Skip to Content
Merck
CN

EHU009401

MISSION® esiRNA

targeting human LIFR

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human LIFR

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGATGCACCTCCCCATTAATTCTACTGTGGAAGATATAGCTGCAGAAGAGGACTTAGATAAAACTGCGGGTTACAGACCTCAGGCCAATGTAAATACATGGAATTTAGTGTCTCCAGACTCTCCTAGATCCATAGACAGCAACAGTGAGATTGTCTCATTTGGAAGTCCATGCTCCATTAATTCCCGACAATTTTTGATTCCTCCTAAAGATGAAGACTCTCCTAAATCTAATGGAGGAGGGTGGTCCTTTACAAACTTTTTTCAGAACAAACCAAACGATTAACAGTGTCACCGTGTCACTTCAGTCAGCCATCTCAATAAGCTCTTACTGCTAGTGTTGCTACATCAGCACTGGGCATTCTTGGAGGGATCCTGTGAAGTATTGTTAGGAGGTGAACTTCACTACATGTTAAGTTACACTGAAAGTGTTCATGTGCTTTTAATGTAGTCTAAAAGCCAAAGTATAGTGACTCAGAATCCTCAATCCACAAAACTCAAGATTGGGAGCTCTTTGTGATCAAGCCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hao-Xuan Wu et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(9 Pt B), 2769-2784 (2018-05-12)
Leukemia inhibitory factor receptor (LIFR) has been documented as a cancer promoter and to be present at high levels in various types of tumor tissues. In our search for molecules prognostic of colorectal cancer (CRC), we found high levels of
Qin Luo et al.
Oncotarget, 6(9), 6989-6999 (2015-03-10)
Differential diagnosis of well-differentiated hepatocellular carcinoma (WD-HCC) and high-grade dysplastic nodules (HGDNs) represents a challenge for pathologists. Several immunohistochemistry markers have been identified to distinguish hepatocellular carcinoma (HCC) from HGDNs. However, sensitivity or specificity of the individual marker is still
Chengyong Lei et al.
DNA and cell biology, 37(8), 659-669 (2018-06-15)
The role of leukemia inhibitory factor receptor (LIFR), which is important in the signal transduction of the interleukin-6 cytokine family, is still undefined in clear cell renal cell carcinoma (ccRCC). Thus, we examined the function and mechanism of LIFR in
Shi-Bo Bian et al.
Annals of the New York Academy of Sciences, 1484(1), 74-89 (2020-08-23)
The long-term outcome of gastric cancer (GC) patients remains unsatisfactory despite some recent improvements. Leukemia inhibitory factor (LIF) is a prognostic biomarker for some solid tumors, however its role in GC remains unknown. In this study, we demonstrated that LIF

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service