Skip to Content
Merck
CN

EHU015991

Sigma-Aldrich

MISSION® esiRNA

targeting human SSRP1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAAACTCGCTACCACTTCCTGATCCTCCTCTTCTCCAAGGACGAGGACATTTCGTTGACTCTGAACATGAACGAGGAAGAAGTGGAGAAGCGCTTTGAGGGTCGGCTCACCAAGAACATGTCAGGATCCCTCTATGAGATGGTCAGCCGGGTCATGAAAGCACTGGTAAACCGCAAGATCACAGTGCCAGGCAACTTCCAAGGGCACTCAGGGGCCCAGTGCATTACCTGTTCCTACAAGGCAAGCTCAGGACTGCTCTACCCGCTGGAGCGGGGCTTCATCTACGTCCACAAGCCACCTGTGCACATCCGCTTCGATGAGATCTCCTTTGTCAACTTTGCTCGTGGTACCACTACTACTCGTTCCTTTGACTTTGAAATTGAGACCAAGCAGGGCACTCAGTATACCTTCAGCAGCATTGAGAGGGAGGAGTACGGGAAACTGTTTGATTTTGTCAACGCGAAAAAGCTCAACATCAAAAACCGAGGATTGAAAGAGGGCATGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenyong Long et al.
Journal of molecular cell biology, 10(2), 147-160 (2018-02-17)
The differentiation status of neuroblastoma (NB) strongly correlates with its clinical outcomes; however, the molecular mechanisms driving maintenance of stemness and differentiation remain poorly understood. Here, we show that plant homeodomain finger-containing protein 20 (PHF20) functions as a critical epigenetic
Ying Gao et al.
Cancer research, 77(10), 2674-2685 (2017-04-19)
DNA single-strand breaks (SSB) are the most common form of DNA damage, requiring repair processes that to initiate must overcome chromatin barriers. The FACT complex comprised of the SSRP1 and SPT16 proteins is important for maintaining chromatin integrity, with SSRP1
Alan S Wang et al.
Molecular cell, 79(2), 221-233 (2020-07-01)
Cas9 is a prokaryotic RNA-guided DNA endonuclease that binds substrates tightly in vitro but turns over rapidly when used to manipulate genomes in eukaryotic cells. Little is known about the factors responsible for dislodging Cas9 or how they influence genome engineering.
Ling Bi et al.
International journal of cancer, 145(1), 164-178 (2018-12-15)
Cancer cell repopulation through cell cycle re-entry by quiescent (G0 ) cell is thought to be an important mechanism behind treatment failure and cancer recurrence. Facilitates Chromatin Transcription (FACT) is involved in DNA repair, replication and transcription by eviction of
Miranda M Tallman et al.
Cancer letters, 499, 232-242 (2020-12-01)
Glioblastoma (GBM) is an incurable brain tumor with inevitable recurrence. This is in part due to a highly malignant cancer stem cell (CSC) subpopulation of tumor cells that is particularly resistant to conventional treatments, including radiotherapy. Here we show that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service