Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAAGAATGCTGGAGGAAGGGTGTTTGTCCACTGCCAGGCAGGCATTTCCCGGTCAGCCACCATCTGCCTTGCTTACCTTATGAGGACTAATCGAGTCAAGCTGGACGAGGCCTTTGAGTTTGTGAAGCAGAGGCGAAGCATCATCTCTCCCAACTTCAGCTTCATGGGCCAGCTGCTGCAGTTTGAGTCCCAGGTGCTGGCTCCGCACTGTTCGGCAGAGGCTGGGAGCCCCGCCATGGCTGTGCTCGACCGAGGCACCTCCACCACCACCGTGTTCAACTTCCCCGTCTCCATCCCTGTCCACTCCACGAACAGTGCGCTGAGCTACCTTCAGAGCCCCATTACGACCTCTCCCAGCTGCTGAAAGGCCACGGGAGGTGAGGCTCTTCACATCCCATTGGGACTCCATGCTCCTTGAGAGGAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DUSP1(1843)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Fang-Fang Guo et al.
Toxicology mechanisms and methods, 30(6), 407-416 (2020-04-03)
Mitogen-activated protein kinases (MAPKs) are versatile proteins that have been suggested to be involved in the regulation of lipid metabolism. This study was designed to investigate the responses of MAPK signaling to chronic ethanol exposure in vivo and in vitro, and try
Siyu Lei et al.
Oncology letters, 20(2), 1743-1751 (2020-07-30)
Mitogen activated protein kinase phosphatase-1 (MKP-1) has been revealed to be overexpressed in bladder cancer, particularly in non-muscle invasive bladder cancer. MKP-1 may also be associated with chemotherapy resistance. However, the underlying mechanism is yet to be elucidated. The current
Chaoyong He et al.
Diabetes, 64(12), 4285-4297 (2015-04-11)
Activation of AMPK suppresses inflammation, but the underlying mechanisms remain poorly understood. This study was designed to characterize the molecular mechanisms by which AMPK suppresses vascular inflammation. In cultured human aortic smooth muscle cells, pharmacologic or genetic activation of AMPK
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU016821-20UG | 04061831339710 |
| EHU016821-50UG | 04061828339402 |