Skip to Content
Merck
CN

EHU019961

MISSION® esiRNA

targeting human TNFAIP3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human TNFAIP3

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAGTTTCGGGAGATCATCCACAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAAGCCAGAAGAAACTCAACTGGTGTCGAGAAGTCCGGAAGCTTGTGGCGCTGAAAACGAACGGTGACGGCAATTGCCTCATGCATGCCACTTCTCAGTACATGTGGGGCGTTCAGGACACAGACTTGGTACTGAGGAAGGCGCTGTTCAGCACGCTCAAGGAAACAGACACACGCAACTTTAAATTCCGCTGGCAACTGGAGTCTCTCAAATCTCAGGAATTTGTTGAAACGGGGCTTTGCTATGATACTCGGAACTGGAATGATGAATGGGACAATCTTATCAAAATGGCTTCCACAGACACACCCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongjun Zhao et al.
Rheumatology (Oxford, England), 56(5), 835-843 (2017-02-06)
TNF-α-induced protein 3 ( TNFAIP3 ) is one of the major SLE susceptibility genes involved in the regulation of inflammatory responses through modulation of the nuclear factor-κB (NF-κB) pathway. We aim to assess TNFAIP3 expression in CD4 + T cells
Wenjing Feng et al.
Biochemical and biophysical research communications, 482(4), 1107-1113 (2016-12-05)
The innate immune response provides the first line of defense against viruses and other pathogens by responding to specific microbial molecules. A20 is a cytoplasmic ubiquitin-editing protein that negatively regulates the retinoic acid-inducible gene I (RIG-I)-mediated activation of interferon regulatory
Meng Qin et al.
Frontiers in pharmacology, 8, 953-953 (2018-01-10)
Atherosclerosis (AS) is a chronic inflammatory disease and endothelial cell injury is the initial event. In this study, we investigated the protective effects of ginsenoside F1 (GF1) on AS and the potential molecular mechanisms of ox-LDL induced endothelial injury. ApoE-/-
Ming-Yang Li et al.
Oncotarget, 7(48), 79914-79924 (2016-11-09)
The regulatory B cells (Breg) are important in the body immunity. The differentiation process of Breg is not fully understood yet. Ubiquitin A20 has immune regulatory functions. This study aims to investigate the role of A20 in the regulation of
Zhipeng Li et al.
Brain, behavior, and immunity, 79, 228-235 (2019-02-11)
Neuroinflammation is now recognized to be a feature of many neurological disorders. More accumulated evidences suggested chrysin which was contained in honey, propolis, vegetables, fruits and plants can exert biological activities including anti-neuroinflammatory effects. However, the precise molecular mechanisms of

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service