Skip to Content
Merck
CN

EHU029161

MISSION® esiRNA

targeting human TRIM32

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Quality Level

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCTGACAGTAGTCGCAAGGAAATTCTCCATTTTCCTAAGGGTGGGGGCTATAGTGTCCTTATTCGAGAGGGACTTACCTGTCCGGTGGGCATAGCCCTAACTCCTAAGGGGCAGCTGCTGGTCTTGGACTGTTGGGATCATTGCATCAAGATCTACAGCTACCATCTGAGAAGATATTCCACCCCATAGGGGATGAGAAATTATCAGTTTCTTCTGCTCCCAAGCCAACTTCCCTTCCCTTAGTTCTTGGTTGTTAGTGGCACATGCAGAATAGACTCAGCCTATGTCCTGATTCCAGCTGGGTAGTTCTAGAACTTCAGAAGCTCCATCTTTTAATGTTTTTATTTGTTATGTCCCCCTCCCCGCTTCCCACCTAAATTTAGAGCTTTAAAAGATGCACTGCCCAAATAGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hao Cui et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 801-811 (2017-09-28)
Epithelial cells play important roles as a critical barrier in protecting the cornea from microbial pathogens infection. In this study, we were aiming to investigate the role of E3 ubiquitin ligase tripartite motif protein 32 (TRIM32) in corneal epithelial cells
Maria Angeliki S Pavlou et al.
Molecular neurobiology, 54(6), 4257-4270 (2016-06-25)
Alpha-synuclein is an abundant neuronal protein which has been associated with physiological processes like synaptic function, neurogenesis, and neuronal differentiation but also with pathological neurodegeneration. Indeed, alpha-synuclein (snca) is one of the major genes implicated in Parkinson's disease (PD). However
Sarah Gilbertson et al.
eLife, 7 (2018-10-04)
Alterations in global mRNA decay broadly impact multiple stages of gene expression, although signals that connect these processes are incompletely defined. Here, we used tandem mass tag labeling coupled with mass spectrometry to reveal that changing the mRNA decay landscape
Hideki Izumi et al.
Cancer research, 74(19), 5620-5630 (2014-08-08)
Asymmetric cell division (ACD) is a physiologic process during development and tissue homeostasis. ACD produces two unequal daughter cells: one has stem/progenitor cell activity and the other has potential for differentiation. Recent studies showed that misregulation of the balance between

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service