Skip to Content
Merck
CN

EHU030731

MISSION® esiRNA

targeting human NEU3

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACCCAAGCCAATTCAAAAGCAATTAATTGGCTTAGGACCCAATTTCCATAGATGCAAATGGCAGTTACAGACAGGTTAACAGAAGCTACTGAAGTCTACAGATAATCAAAAAACTTAATATTCTGTTCCCTACCTTTTTTCACTTTTCCTCCTCCAAAGAGCAAAATGAAAATTTTGCCTTAGCTACTGCAGTGGAAAGAGCACTGAACTAGGAGTTGGAAGACAAGGATGTGGTCCTGGCTCTGCCACTGGCTTGCTTTTGGACCTTGGATGTGTCACCTGAACTCTCTGGACCTCAGGTTTCCATCTGTAAAATGAGAGTATTGGTTCTAAGATTTCTCATCTTCTCATCCCTAGGACAAGCATAGTGCCTGCATGCTTCATGATCAGTAAGTCCTGGCTGCATAAAGGA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Md Amran Howlader et al.
ACS chemical biology, 15(6), 1328-1339 (2020-04-21)
The human neuraminidase enzymes (NEU1, NEU2, NEU3, and NEU4) are a class of enzymes implicated in pathologies including cancer and diabetes. Several reports have linked neuraminidase activity to the regulation of cell migration in cancer cells. Using an in vitro
Kazuhiro Shiozaki et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(5), 2099-2111 (2015-02-14)
The plasma membrane-associated sialidase NEU3 plays crucial roles in regulation of transmembrane signaling, and its aberrant up-regulation in various cancers contributes to malignancy. However, it remains uncertain how NEU3 is naturally activated and locates to plasma membranes, because of its

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service