Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CATCGTGAACTGGCTGAAGAAGCGCACGGGCCCGGCTGCCACCACCCTGCCTGACGGCGCAGCTGCAGAGTCCTTGGTGGAGTCCAGCGAGGTGGCTGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTCTGCCAAGCAGTTTTTGCAGGCAGCAGAGGCCATCGATGACATACCATTTGGGATCACTTCCAACAGTGACGTGTTCTCCAAATACCAGCTCGACAAAGATGGGGTTGTCCTCTTTAAGAAGTTTGATGAAGGCCGGAACAACTTTGAAGGGGAGGTCACCAAGGAGAACCTGCTGGACTTTATCAAACACAACCAGCTGCCCCTTGTCATCGAGTTCACCGAGCAGACAGCCCCGAAGATTTTTGGAGGTGAAATCAAGACTCACATCCTGCTGTTCTTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... P4HB(5034)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Rashed Alhammad et al.
Oncology reports, 44(6), 2406-2418 (2020-10-31)
Oxidoreductase protein disulphide isomerases (PDI) are involved in the regulation of a variety of biological processes including the modulation of endoplasmic reticulum (ER) stress, unfolded protein response (UPR), ER‑mitochondria communication and the balance between pro‑survival and pro‑death pathways. In the
Yajing Liu et al.
Cancer research, 79(11), 2923-2932 (2019-04-19)
Patients with glioblastoma multiforme (GBM) survive on average 12 to 14 months after diagnosis despite surgical resection followed by radiotheraphy and temozolomide therapy. Intrinsic or acquired resistance to chemo- and radiotherapy is common and contributes to a high rate of
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU032931-20UG | 04061831340846 |
| EHU032931-50UG | 04061828308583 |