Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACCCTTCTCCTCCACCAAGTCCTTCTCAGCAAATCAACCTTGGCCCGTCGTCCAATCCTCATGCTAAACCATCTGACTTTCACTTCTTGAAAGTGATCGGAAAGGGCAGTTTTGGAAAGGTTCTTCTAGCAAGACACAAGGCAGAAGAAGTGTTCTATGCAGTCAAAGTTTTACAGAAGAAAGCAATCCTGAAAAAGAAAGAGGAGAAGCATATTATGTCGGAGCGGAATGTTCTGTTGAAGAATGTGAAGCACCCTTTCCTGGTGGGCCTTCACTTCTCTTTCCAGACTGCTGACAAATTGTACTTTGTCCTAGACTACATTAATGGTGGAGAGTTGTTCTACCATCTCCAGAGGGAACGCTGCTTCCTGGAACCACGGGCTCGTTTCTATGCTGCTGAAATAGCCAGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SGK1(6446)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Eneda Toska et al.
Cell reports, 27(1), 294-306 (2019-04-04)
The PI3K pathway integrates extracellular stimuli to phosphorylate effectors such as AKT and serum-and-glucocorticoid-regulated kinase (SGK1). We have previously reported that the PI3K pathway regulates estrogen receptor (ER)-dependent transcription in breast cancer through the phosphorylation of the lysine methyltransferase KMT2D
Jakob Voelkl et al.
The Journal of clinical investigation, 128(7), 3024-3040 (2018-06-12)
Medial vascular calcification, associated with enhanced mortality in chronic kidney disease (CKD), is fostered by osteo-/chondrogenic transdifferentiation of vascular smooth muscle cells (VSMCs). Here, we describe that serum- and glucocorticoid-inducible kinase 1 (SGK1) was upregulated in VSMCs under calcifying conditions.
Florian Poetsch et al.
International journal of molecular sciences, 21(19) (2020-10-03)
In diabetes mellitus, hyperglycemia promotes the osteogenic transdifferentiation of vascular smooth muscle cells (VSMCs) to enhance medial vascular calcification, a common complication strongly associated with cardiovascular disease and mortality. The mechanisms involved are, however, still poorly understood. Therefore, the present
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU035381-20UG | 04061831341270 |
| EHU035381-50UG | 04061831362169 |