Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGACCAGAACTGGCAGGAAGCTGCACTTGGGAGTGATGATTCCAAGGCTACCATGCTATTCTTCCACTTCTTGGATCAGCTGAACTATGAGTGTGGCCGTTGCAGCCAGGACCCAGAGTCCTTGTTGCTGCAGCACAATTTGCGGAAATTCTGCCGGGACATTCAGCCCTTTTCCCAGGATCCTACCCAGTTGGCTGAGATGATCTTTAACCTCCTTCTGGAAGAAAAAAGAATTTTGATCCAGGCTCAGAGGGCCCAATTGGAACAAGGAGAGCCAGTTCTCGAAACACCTGTGGAGAGCCAGCAACATGAGATTGAATCCCGGATCCTGGATTTAAGGGCTATGATGGAGAAGCTGGTAAAATCCATCAGCCAACTGAAAGACCAGCAGGATGTCTTCTGCTTCCGA
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... STAT2(6773)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Katherine R Walter et al.
Oncoimmunology, 9(1), 1758547-1758547 (2020-05-12)
Type I (IFNα/β) interferon signaling represents a critical transduction pathway involved in recognition and destruction of nascent tumor cells. Downregulation of this pathway to promote a more immunosuppressed microenvironment contributes to the ability of tumor cells to evade the immune
Guanming Wang et al.
The Journal of biological chemistry, 294(50), 18969-18979 (2019-10-17)
Cytoplasmic dsRNA is recognized by RNA helicase RIG-I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5), triggering induction of the innate immune response via the mitochondrial antiviral signaling protein (MAVS). In contrast, extracellular dsRNA is internalized into endosomes and recognized by
Adriana Forero et al.
Immunity, 51(3), 451-464 (2019-09-01)
Type I and III interferons (IFNs) activate similar downstream signaling cascades, but unlike type I IFNs, type III IFNs (IFNλ) do not elicit strong inflammatory responses in vivo. Here, we examined the molecular mechanisms underlying this disparity. Type I and III
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU036101-50UG | 04061828311361 |
| EHU036101-20UG | 04061828546657 |