EHU041411
MISSION® esiRNA
targeting human SFSWAP
Select a Size
About This Item
CN¥1,977.17
Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTGTCTGCACCAGAAGAGGCTCCCACAGACTCTGCTCCCGAGAAGCCAAGTGATGCTGGGGAGGATGGCGCGCCTGAAGACGCAGCCGAGGTGGGAGCACGGGCAGGCTCAGGCGGGAAGAAGGAGGCATCGTCCAGTAAGACCGTCCCGGACGGGAAGCTGGTGAAAGCTTCCTTTGCTCCAATAAGCTTTGCAATCAAGGCCAAAGAAAATGATCTGCTTCCCCTGGAAAAAAATCGTGTTAAGCTAGATGATGACAGTGATGATGATGAAGAAAGCAAAGAAGGCCAAGAAAGTTCTAGTAGTGCTGCAAACACTAACCCAGCAGTTGCCCCACCCTGTGTAGTTGTTGAGGAGAAGAAGCCTCAACTTACCCAGGAGGAGCTAGAAGCAAAGCAAGCAAAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SFSWAP(6433), SFRS8(6433)
1 of 1
This Item | A0225000 | 1011007 | PHR1523 |
|---|---|---|---|
| manufacturer/tradename BP | manufacturer/tradename EDQM | manufacturer/tradename USP | manufacturer/tradename - |
| grade pharmaceutical primary standard | grade pharmaceutical primary standard | grade pharmaceutical primary standard | grade certified reference material, pharmaceutical secondary standard |
| form solid | form - | form - | form - |
| format neat | format neat | format neat | format neat |
| application(s) pharmaceutical | application(s) pharmaceutical (small molecule) | application(s) pharmaceutical (small molecule) | application(s) pharmaceutical (small molecule) |
| shelf life limited shelf life, expiry date on the label | shelf life - | shelf life - | shelf life - |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Customers Also Viewed
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service