Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCACTGAGTCATGCGACTTCGTGCGGGCCATGGTGGACCCGGCCCAGACGGTGGAACAGAGGCTGAAGTTGTTCAAGTTGGCGTCTGAGAAGCATCAGCATATGTATCGCCTCGCCATGACCGGCTCTGGGATCGATCGTCACCTCTTCTGCCTTTACGTGGTGTCTAAATATCTCGCTGTGGAGTCCCCTTTCCTTAAGGAAGTTTTATCTGAGCCTTGGAGATTATCAACAAGCCAGACCCCTCAGCAGCAAGTGGAGCTGTTTGACTTGGAGAATAACCCAGAGTACGTGTCCAGCGGAGGGGGCTTTGGACCGGTTGCTGATGACGGCTATGGTGTGTCGTACATCCTTGTGGGAGAGAACCTCATCAATTTCCACATTTCTTCCAAGTTCTCTTGCCCTGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CPT1A(1374)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Seher Balaban et al.
Molecular cancer research : MCR, 17(4), 949-962 (2019-01-17)
Prostate cancer cells exhibit altered cellular metabolism but, notably, not the hallmarks of Warburg metabolism. Prostate cancer cells exhibit increased de novo synthesis of fatty acids (FA); however, little is known about how extracellular FAs, such as those in the
Jin Seok et al.
Stem cell research & therapy, 11(1), 1-1 (2020-01-05)
Human placenta-derived mesenchymal stem cells (PD-MSCs) are powerful sources for cell therapy in regenerative medicine. However, a limited lifespan by senescence through mechanisms that are well unknown is the greatest obstacle. In the present study, we first demonstrated the characterization
Hideki Iwamoto et al.
Cell metabolism, 28(1), 104-117 (2018-06-05)
Intrinsic and evasive antiangiogenic drug (AAD) resistance is frequently developed in cancer patients, and molecular mechanisms underlying AAD resistance remain largely unknown. Here we describe AAD-triggered, lipid-dependent metabolic reprogramming as an alternative mechanism of AAD resistance. Unexpectedly, tumor angiogenesis in adipose
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU041711-50UG | 04061831362503 |
| EHU041711-20UG | 04061831342154 |