Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGCATCAGTTCGCTTAATGAATTCAATCCCATGGGGGACACGCTGGCCTCTGCAATGGGTTACCACATTCTCATCTGGAGCCAGGAGGAAGCCAGGACACGGAAGTGAGAGACACTAAAGAAGGTGTGGGCCAGACAAGGCCTTGGAGCCCACACATGGGATCAAGTCCTGCAAGCAGAGGTGGCGATTTGTTAAAGGGCCAAAAGTATCCAAGGTTAGGGTTGGAGCAGGGGTGCTGGGACCTGGGGCACTGTGGGACTGGGACACTTTTATGTTAATGCTCTGGACTTGCCTCCAGAGACTGCTCCAGAGTTGGTGACACAGCTGTCCCAAGGGCCCCTCTGTATCTAGCCTGGAACCAAGGTTATCTTGGAACTAAATGACTTTTCTCCTCTCAGTGGGTGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DDB2(1643)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sunbok Jang et al.
Nature structural & molecular biology, 26(8), 695-703 (2019-07-25)
UV-DDB, a key protein in human global nucleotide excision repair (NER), binds avidly to abasic sites and 8-oxo-guanine (8-oxoG), suggesting a noncanonical role in base excision repair (BER). We investigated whether UV-DDB can stimulate BER for these two common forms
Qianzheng Zhu et al.
Mutation research, 776, 16-23 (2015-08-11)
Acetylated histone H3 lysine 56 (H3K56Ac) is one of the reversible histone post-translational modifications (PTMs) responsive to DNA damage. We previously described a biphasic decrease and increase of epigenetic mark H3K56Ac in response to ultraviolet radiation (UVR)-induced DNA damage. Here
Hiroyuki Niida et al.
Nature communications, 8, 16102-16102 (2017-07-19)
HBO1, a histone acetyl transferase, is a co-activator of DNA pre-replication complex formation. We recently reported that HBO1 is phosphorylated by ATM and/or ATR and binds to DDB2 after ultraviolet irradiation. Here, we show that phosphorylated HBO1 at cyclobutane pyrimidine
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU042481-50UG | 04061828301966 |
| EHU042481-20UG | 04061831342246 |