Skip to Content
Merck
CN

EHU042991

MISSION® esiRNA

targeting human TERF2

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGCCCTCAAAAACAAGAGACCCAGAAAAGATGAAAACGAAAGTTCAGCCCCGGCTGACGGTGAGGGTGGCTCGGAACTGCAGCCCAAGAACAAGCGCATGACAATAAGCAGATTGGTCTTGGAGGAGGACAGCCAGAGTACTGAGCCCAGCGCAGGCCTCAACTCCTCCCAGGAGGCCGCTTCAGCGCCACCATCCAAGCCCACCGTTCTCAACCAACCCCTCCCTGGAGAGAAGAATCCCAAAGTACCCAAAGGCAAGTGGAACAGCTCTAATGGGGTTGAAGAAAAGGAGACTTGGGTGGAAGAGGATGAACTGTTTCAAGTTCAGGCAGCACCAGATGAAGACAGTACAACCAATATAACAAAAAAGCAGAAGTGGACTGTAGAAGAAAGCGAGTGGGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Venkateswarlu Popuri et al.
Nucleic acids research, 42(9), 5671-5688 (2014-03-14)
A variety of human tumors employ alternative and recombination-mediated lengthening for telomere maintenance (ALT). Human RecQ helicases, such as BLM and WRN, can efficiently unwind alternate/secondary structures during telomere replication and/or recombination. Here, we report a novel role for RECQL1
Deeksha Pal et al.
PloS one, 10(3), e0115651-e0115651 (2015-03-03)
Telomere binding factors viz. TRF1 and TRF2 are a part of sheltrin complex that are present exclusively at the ends of chromosomes. These factors play an important role in maintaining chromosomal integrity at the ends. However, their status and role
Saara Hämälistö et al.
Nature communications, 11(1), 229-229 (2020-01-15)
Lysosomes are membrane-surrounded cytoplasmic organelles filled with a powerful cocktail of hydrolases. Besides degrading cellular constituents inside the lysosomal lumen, lysosomal hydrolases promote tissue remodeling when delivered to the extracellular space and cell death when released to the cytosol. Here

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service