Skip to Content
Merck
CN

EHU044061

Sigma-Aldrich

MISSION® esiRNA

targeting human GPR55

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCTTCCTGCAGTTCCTGGTGAGAAACAGCTTTATCGTAGAGTGCAGAGCCAAGCAGAGCATCAGCTTCTTCTTGCAATTGTCCATGTGTTTCTCCAACGTCAACTGCTGCCTGGATGTTTTCTGCTACTACTTTGTCATCAAAGAATTCCGCATGAACATCAGGGCCCACCGGCCTTCCAGGGTCCAGCTGGTCCTGCAGGACACCACGATCTCCCGGGGCTAACGGAAGGACATCCTGTTCAGGGGAAGAAAGCCCTGGCCCTGAATTCTGGTAACGGATATCGCGTTCCAGGGTTTTGATGTGGTGGGATGATCCGCACCATCTTCACTGATGTGCTTCCCTTTGATGCCCATTGAGTGCCAGCTTTGCTCATTATACCCCAAAGACCTTTTTTCCACTGCCCAGACAGCTTATACCACCCAGTGTTCAGGGATCTCTGAAGAACCCACAGACCAGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Christopher Lipina et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 1299-1312 (2018-08-28)
Emerging evidence indicates that G-protein coupled receptor 55 (GPR55), a nonclassic receptor of the endocannabinoid system that is activated by L-α-lysophosphatidylinositol and various cannabinoid ligands, may regulate endocrine function and energy metabolism. We examined how GPR55 deficiency and modulation affects
Sara Carpi et al.
Anti-cancer drugs, 26(7), 754-762 (2015-05-15)
Human cutaneous melanoma is an aggressive and chemotherapy-resistant type of cancer. AM251 is a cannabinoid type 1 (CB1) receptor antagonist/inverse agonist with off-target antitumor activity against pancreatic and colon cancer cells. The current study aimed to characterize the in-vitro antimelanoma
Nicole A Hofmann et al.
British journal of pharmacology, 172(16), 4107-4118 (2015-05-20)
Highly vascularized ovarian carcinoma secretes the putative endocannabinoid and GPR55 agonist, L-α-lysophosphatidylinositol (LPI), into the circulation. We aimed to assess the involvement of this agonist and its receptor in ovarian cancer angiogenesis. Secretion of LPI by three ovarian cancer cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service