Skip to Content
Merck
CN

EHU044481

MISSION® esiRNA

targeting human SNRK

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAGCATCCTAACATCGTCCGCCTTTATGAAGTTATTGACACCCAGACCAAACTATATCTTATTCTAGAACTTGGGGATGGAGGAGATATGTTTGATTATATAATGAAACATGAGGAGGGTCTTAATGAAGACTTGGCCAAGAAGTATTTTGCTCAGATAGTTCATGCTATATCTTATTGCCATAAACTCCATGTGGTTCACAGAGACTTAAAACCAGAGAATGTAGTCTTCTTTGAAAAACAAGGTCTTGTAAAGTTGACAGACTTTGGGTTCAGCAACAAATTTCAACCAGGGAAGAAGCTCACTACAAGCTGTGGATCTCTTGCATATTCCGCTCCAGAAATTCTGCTTGGTGATGAGTATGATGCACCTGCAGTAGATATTTGGAGTCTGGGAGTGATCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Stephanie M Cossette et al.
Biology open, 4(1), 48-61 (2014-12-17)
In this study, we have identified a novel member of the AMPK family, namely Sucrose non-fermenting related kinase (Snrk), that is responsible for maintaining cardiac metabolism in mammals. SNRK is expressed in the heart, and brain, and in cell types
Amy K Rines et al.
Nature communications, 8, 14095-14095 (2017-01-25)
Ischaemic heart disease limits oxygen and metabolic substrate availability to the heart, resulting in tissue death. Here, we demonstrate that the AMP-activated protein kinase (AMPK)-related protein Snf1-related kinase (SNRK) decreases cardiac metabolic substrate usage and mitochondrial uncoupling, and protects against

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service