Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTCCACGGAATCAAACCTCGCTACACGGGGACTTATAATGCGTACAGAATAATAGCAACAACCGAAGGCTTGACGGGTCTTTGGAAAGGGACTACTCCCAATCTGATGAGAAGTGTCATCATCAATTGTACAGAGCTAGTAACATATGATCTAATGAAGGAGGCCTTTGTGAAAAACAACATATTAGCAGATGACGTCCCCTGCCACTTGGTGTCGGCTCTTATCGCTGGATTTTGCGCAACAGCTATGTCCTCCCCGGTGGATGTAGTAAAAACCAGATTTATTAATTCTCCACCAGGACAGTACAAAAGTGTGCCCAACTGTGCAATGAAAGTGTTCACTAACGAAGGACCAACGGCTTTCTTCAAGGGGTTGGTACCTTCCTTCTTGCGACTTGGAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... UCP1(7350)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Zhiyong Xiong et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 6(10), 1801862-1801862 (2019-05-28)
Emerging evidence has highlighted the important role of abnormal lipid accumulation in cancer development and progression, but the mechanism for this phenomenon remains unclear. Here, it is demonstrated that phospholipase C-like 1/uncoupling protein 1 (PLCL1)/(UCP1)-mediated lipid browning promotes tumor cell
Jung Hwa Lim et al.
PloS one, 11(9), e0163710-e0163710 (2016-09-30)
Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended
Jae Hoon Jeong et al.
Scientific reports, 8(1), 6672-6672 (2018-04-29)
Release of fatty acids from lipid droplets upon activation of the sympathetic nervous system (SNS) is a key step in nonshivering thermogenesis in brown adipose tissue (BAT). However, intracellular lipolysis appears not to be critical for cold-induced thermogenesis. As activation
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU051021-50UG | 04061828337026 |
| EHU051021-20UG | 04061828572120 |