Skip to Content
Merck
CN

EHU051601

MISSION® esiRNA

targeting human SMAD1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACAATCGTGTGGGTGAAGCGTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGTTTCACTGATCCTTCCAACAATAAGAACCGTTTCTGCCTTGGGCTGCTCTCCAATGTTAACCGGAATTCCACTATTGAAAACACCAGGCGGCATATTGGAAAAGGAGTTCATCTTTATTATGTTGGAGGGGAGGTGTATGCCGAATGCCTTAGTGACAGTAGCATCTTTGTGCAAAGTCGGAACTGCAACTACCATCATGGATTTCATCCTACTACTGTTTGCAAGATCCCTAGTGGGTGTAGTCTGAAAATTTTTAACAACCAAGAATTTGCTCAGTTATTGGCACAGTCTGTGAACCATGGATTTGAGACAGTCTATGAGCTTACAAAAATGTGTACTATACGTATGAGCTTTGTGAAGGGCTGGGGAGCAGAATACCACCGCCAGGATGTTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Ram Kim et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(12), 9475-9486 (2015-07-01)
Bone morphogenetic proteins (BMPs) have been involved in metastatic progression and tumorigenesis of many cancer types. However, it remains unclear how BMP-2 contributes to the initiation and development of these cancers. Here, we investigated the role of BMP-2 in colon
Dawid Wnuk et al.
Scientific reports, 10(1), 16492-16492 (2020-10-07)
Airway remodelling with subepithelial fibrosis, which abolishes the physiological functions of the bronchial wall, is a major issue in bronchial asthma. Human bronchial fibroblasts (HBFs) derived from patients diagnosed with asthma display in vitro predestination towards TGF-β1-induced fibroblast-to-myofibroblast transition (FMT)
X Su et al.
Cell death & disease, 6, e1851-e1851 (2015-08-08)
MicroRNAs (miRNAs) emerge as important regulators of stem cell lineage commitment and bone development. MiRNA-26a (miR-26a) is one of the important miRNAs regulating osteogenic differentiation of both bone marrow-derived mesenchymal stem cells (BMSCs) and adipose tissue-derived mesenchymal stem cells (ADSCs).

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service