Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTCGCTAATGAGCCTTTGCTTTTCTTTGGAGTCATGTTCTATGTGCCAAATGTGTCATGGCTTCAGCAAGAGGCCACAAGATATCAGTATTACCTGCAAGTCAAAAAAGATGTGCTTGAAGGGCGATTACGATGTACATTGGACCAGGTGATTCGGCTAGCCGGCCTAGCTGTGCAAGCTGATTTTGGAGACTATAATCAGTTTGATTCTCAAGATTTCCTCAGAGAGTATGTGCTATTTCCTATGGATTTGGCCCTGGAAGAGGCTGTTCTGGAGGAGCTGACCCAGAAGGTAGCCCAAGAACACAAAGCCCACAGTGGAATCCTGCCAGCAGAAGCTGAACTGATGTACATCAATGAAGTTGAACGTTTGGATGGATTTGGACAGGAAATCTTCCCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTPN14(5784)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Natalia I Díaz-Valdivia et al.
Oncogene, 39(18), 3693-3709 (2020-03-11)
Caveolin-1 (CAV1) enhanced migration, invasion, and metastasis of cancer cells is inhibited by co-expression of the glycoprotein E-cadherin. Although the two proteins form a multiprotein complex that includes β-catenin, it remained unclear how this would contribute to blocking the metastasis
Ana Lonic et al.
The Journal of cell biology, 220(2) (2021-01-08)
Receptor degradation terminates signaling by activated receptor tyrosine kinases. Degradation of EGFR occurs in lysosomes and requires the switching of RAB5 for RAB7 on late endosomes to enable their fusion with the lysosome, but what controls this critical switching is
Yujie Yang et al.
British journal of pharmacology, 178(7), 1524-1540 (2021-01-22)
Disturbed flow induces endothelial dysfunction and contributes to uneven distribution of atherosclerotic plaque. Emerging evidence suggests that harmine, a natural constituent of extracts of Peganum harmala, has potent beneficial activities. Here, we investigated if harmine has an atheroprotective role under
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU054171-50UG | 04061828323074 |
| EHU054171-20UG | 04061828557448 |