Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCCACCACCTTAATAGACGACACAAGTAGTGAGGTGCTGGATGAGCTCTACAGAGTGACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAGAAGATCATCAAGAACCTCATCAAGACAGTCATCAAGCTGGCCATTCTTTATAGGAATAATCAGTTTAATCAAGATGAGCTAGCATTGATGGAGAAATTTAAGAAGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGTTTCCATCAGGTGGATTATACCTTTGACCGGAATGTGTTATCCAGGCTGTTAAATGAATGCAGAGAGATGCTGCACCAAATCATTCAGCGCCACCTCACTGCCAAGTCACATGGACGGGTTAATAATGTGTTTGATCATTTTTCAGATTGTGAATTTTTGGCTGCC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TNFAIP8(25816)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yong Han et al.
Molecular carcinogenesis, 57(2), 159-166 (2017-09-20)
TNFAIP8 is associated with prognosis of several human malignancies. However, the molecular mechanism of TNFAIP8 in lung cancer remains unknown. In our study, we found TNFAIP8 could enhance TEAD luciferase activity and inhibits the activity of Hippo pathway. TNFAIP8 also
Suryakant Niture et al.
The international journal of biochemistry & cell biology, 130, 105885-105885 (2020-11-24)
Tumor necrosis factor-α-induced protein 8 (TNFAIP8) is a member of TIPE/TNFAIP8 family, has been involved in the development and progression of various human cancers. We hypothesized that TNFAIP8 promotes prostate cancer (PCa) progression via regulation of oxidative phosphorylation (OXPHOS) and
Qianze Dong et al.
Oncotarget, 8(9), 15689-15703 (2017-02-06)
Although TNFAIP8 overexpression has been implicated in several human cancers, its clinical significance and biological function in hepatocellular carcinoma (HCC) remains unknown. Our study demonstrated that TNFAIP8 overexpression in primary HCC samples correlated with TNM stage, recurrence, poor prognosis and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU054891-20UG | 04061828558070 |
| EHU054891-50UG | 04061828323753 |