Skip to Content
Merck
CN

EHU054891

MISSION® esiRNA

targeting human TNFAIP8

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCCACCACCTTAATAGACGACACAAGTAGTGAGGTGCTGGATGAGCTCTACAGAGTGACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAGAAGATCATCAAGAACCTCATCAAGACAGTCATCAAGCTGGCCATTCTTTATAGGAATAATCAGTTTAATCAAGATGAGCTAGCATTGATGGAGAAATTTAAGAAGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGTTTCCATCAGGTGGATTATACCTTTGACCGGAATGTGTTATCCAGGCTGTTAAATGAATGCAGAGAGATGCTGCACCAAATCATTCAGCGCCACCTCACTGCCAAGTCACATGGACGGGTTAATAATGTGTTTGATCATTTTTCAGATTGTGAATTTTTGGCTGCC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yong Han et al.
Molecular carcinogenesis, 57(2), 159-166 (2017-09-20)
TNFAIP8 is associated with prognosis of several human malignancies. However, the molecular mechanism of TNFAIP8 in lung cancer remains unknown. In our study, we found TNFAIP8 could enhance TEAD luciferase activity and inhibits the activity of Hippo pathway. TNFAIP8 also
Qianze Dong et al.
Oncotarget, 8(9), 15689-15703 (2017-02-06)
Although TNFAIP8 overexpression has been implicated in several human cancers, its clinical significance and biological function in hepatocellular carcinoma (HCC) remains unknown. Our study demonstrated that TNFAIP8 overexpression in primary HCC samples correlated with TNM stage, recurrence, poor prognosis and
Suryakant Niture et al.
The international journal of biochemistry & cell biology, 130, 105885-105885 (2020-11-24)
Tumor necrosis factor-α-induced protein 8 (TNFAIP8) is a member of TIPE/TNFAIP8 family, has been involved in the development and progression of various human cancers. We hypothesized that TNFAIP8 promotes prostate cancer (PCa) progression via regulation of oxidative phosphorylation (OXPHOS) and
Xinhong Ge et al.
Scientific reports, 11(1), 5660-5660 (2021-03-13)
Tumor necrosis factor-α-induced protein 8 (TNFAIP8) is a member of the TIPE/TNFAIP8 family which regulates tumor growth and survival. Our goal is to delineate the detailed oncogenic role of TNFAIP8 in skin cancer development and progression. Here we demonstrated that
Suxia Wu et al.
Oncology letters, 17(5), 4667-4674 (2019-04-05)
Cervical cancer is the second most prevalent malignant tumor in women worldwide. Failure of successful treatment is most prevalent in patients with the metastatic disease and the chemotherapy refractory disease. Tumor necrosis factor α-induced protein 8 (TNFAIP8) serves as an

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service