Skip to Content
Merck
CN

EHU055241

MISSION® esiRNA

targeting human TMBIM6

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGGGCTCCCTGATATTGATGATTTGGCTGATGGCAACACCTCATAGCCATGAAACTGAACAGAAAAGACTGGGACTTCTTGCTGGATTTGCATTCCTTACAGGAGTTGGCCTGGGCCCTGCCCTGGAGTTTTGTATTGCTGTCAACCCCAGCATCCTTCCCACTGCTTTCATGGGCACGGCAATGATCTTTACCTGCTTCACCCTCAGTGCACTCTATGCCAGGCGCCGTAGCTACCTCTTTCTGGGAGGTATCTTGATGTCAGCCCTGAGCTTGTTGCTTTTGTCTTCCCTGGGGAATGTTTTCTTTGGATCCATTTGGCTTTTCCAGGCAAACCTGTATGTGGGACTGGTGGTCATGTGTGGCTTCGTCCTTTTTGATACTCAACTCATTATTGAAAAGGCCGAACATGGAGATCAAGATTATATCTGGCACTGCATTGATCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dan Wu et al.
Neural regeneration research, 7(17), 1331-1337 (2012-06-15)
A human SH-SY5Y neuroblastoma cell line with a low level of Bax inhibitor-1 expression was established by lentivirus-mediated RNA interference and fluorescence-activated cell sorting. In control SH-SY5Y cells, tunicamycin treatment induced endoplasmic reticulum stress-mediated apoptosis; however, after Bax inhibitor-1 gene
Yam Prasad Aryal et al.
Journal of cellular physiology, 234(11), 20354-20365 (2019-04-10)
To understand the role of endoplasmic reticulum (ER)-stress in mice molar development, we studied Tmbim6 that antagonizes the unfolded protein response, using Tmbim6 knockout (KO) mice and in vitro organ cultivation with knocking down using small interfering RNA. During molar
Andromachi Kotsafti et al.
BMC gastroenterology, 10, 35-35 (2010-04-03)
Bax inhibitor-1 (BI-1) is an evolutionary conserved endoplasmic reticulum protein that, when overexpressed in mammalian cells, suppresses the apoptosis induced by Bax, a pro-apoptotic member of the Bcl-2 family. The aims of this study were: (1) to clarify the role

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service