Skip to Content
Merck
CN

EHU057021

Sigma-Aldrich

MISSION® esiRNA

targeting human NANOS3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAAAGAGGGTCCTGAAACCAGGCTGAGCCCCCAGCCAGAGCCAGAGCCAATGCTGGAGCCGGATCAGAAGCGCAGCCTGGAGTCCTCGCCAGCTCCCGAACGCCTGTGCTCTTTCTGCAAACACAACGGCGAGTCCCGGGCCATCTACCAGTCCCACGTGCTGAAGGACGAGGCTGGCAGGGTGCTGTGTCCCATCCTGCGGGACTACGTGTGTCCCCAGTGCGGCGCCACACGTGAGCGCGCCCACACCCGACGCTTCTGCCCACTTACTGGCCAGGGCTACACCTCCGTCTACAGCCACACCACCCGAAACTCGGCAGGCAAGAAGCTGGTCCGGCCTGACAAGGCGAAGACACAGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ye Tian et al.
Endocrinology, 158(6), 1898-1915 (2017-03-23)
Thyroid hormones are important for normal reproductive function. Although 3,5,3'-triiodothyronine (T3) enhances follicle-stimulating hormone (FSH)-induced preantral follicle growth and granulosa cells development in vitro, little is known about the molecular mechanisms regulating ovarian development via glucose. In this study, we
Paul Guerby et al.
Redox biology, 22, 101126-101126 (2019-02-10)
Decreased nitric oxide (NO) bioavailability plays a critical role in the pathophysiology of preeclampsia (PE). Recent evidence indicates that S-glutathionylation may occur on the endothelial nitric oxide synthase (eNOS), leading to eNOS uncoupling, characterized by a decreased NO production and
Yaqiu Li et al.
American journal of physiology. Cell physiology, 318(3), C463-C475 (2020-01-01)
Published studies indicate that TMEM184A is a heparin receptor that interacts with and transduces stimulation from heparin in vascular cells. Previous studies have indicated that heparin increases endothelial nitric oxide synthase (eNOS) activity in bovine endothelial cells. However, the precise

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service