Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGAAAGAGGGTCCTGAAACCAGGCTGAGCCCCCAGCCAGAGCCAGAGCCAATGCTGGAGCCGGATCAGAAGCGCAGCCTGGAGTCCTCGCCAGCTCCCGAACGCCTGTGCTCTTTCTGCAAACACAACGGCGAGTCCCGGGCCATCTACCAGTCCCACGTGCTGAAGGACGAGGCTGGCAGGGTGCTGTGTCCCATCCTGCGGGACTACGTGTGTCCCCAGTGCGGCGCCACACGTGAGCGCGCCCACACCCGACGCTTCTGCCCACTTACTGGCCAGGGCTACACCTCCGTCTACAGCCACACCACCCGAAACTCGGCAGGCAAGAAGCTGGTCCGGCCTGACAAGGCGAAGACACAGGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NANOS3(342977)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ye Tian et al.
Endocrinology, 158(6), 1898-1915 (2017-03-23)
Thyroid hormones are important for normal reproductive function. Although 3,5,3'-triiodothyronine (T3) enhances follicle-stimulating hormone (FSH)-induced preantral follicle growth and granulosa cells development in vitro, little is known about the molecular mechanisms regulating ovarian development via glucose. In this study, we
Yaqiu Li et al.
American journal of physiology. Cell physiology, 318(3), C463-C475 (2020-01-01)
Published studies indicate that TMEM184A is a heparin receptor that interacts with and transduces stimulation from heparin in vascular cells. Previous studies have indicated that heparin increases endothelial nitric oxide synthase (eNOS) activity in bovine endothelial cells. However, the precise
Paul Guerby et al.
Redox biology, 22, 101126-101126 (2019-02-10)
Decreased nitric oxide (NO) bioavailability plays a critical role in the pathophysiology of preeclampsia (PE). Recent evidence indicates that S-glutathionylation may occur on the endothelial nitric oxide synthase (eNOS), leading to eNOS uncoupling, characterized by a decreased NO production and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU057021-20UG | 04061828560042 |
| EHU057021-50UG | 04061828314164 |