Skip to Content
Merck
CN

EHU058751

MISSION® esiRNA

targeting human VAV2

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCGAGATATGAGGGAGCTTTCGCTGCGGGAGGGTGACGTGGTGAGGATCTACAGCCGCATCGGCGGAGACCAGGGCTGGTGGAAGGGCGAGACCAACGGACGGATTGGCTGGTTTCCTTCAACGTACGTAGAAGAGGAGGGCATCCAGTGACGGCAGGAACGTGGACAAGACTCGCAGATTTTCTTGGGAGAGTCACTCCAGCCCTGAAGTCTGTCTCTAGCTCCTCTGTGACTCAGAGGGGAAATACCAACCTCCCAGTCTTCCACTGCCCACAGGGATAGGGAGGGTGTTGAGAATCCTAAACTCGAACCGTTTCACTGTCAGCCTGCCCTCGGCGACCCATCACTGGGTATGCTATTGTACATAGAGGAAACCTGGGCTAGCCCCACCCAGAGCGCAGAGGAGGGGGCACCGACAGCGCTGCGAGCCAGGCTCTGGGTAGTGGCTGAGGCCAGAGGCCCATCGCCTGCCCCTGTCCAACTGAGATGGCCTTCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Keiko Fujikawa et al.
PloS one, 5(2), e9050-e9050 (2010-02-09)
Glaucoma is a leading cause of blindness worldwide. Nonetheless, the mechanism of its pathogenesis has not been well-elucidated, particularly at the molecular level, because of insufficient availability of experimental genetic animal models. Here we demonstrate that deficiency of Vav2 and
L S Havel et al.
Oncogene, 34(15), 1979-1990 (2014-05-27)
Vimentin is an intermediate filament protein whose expression correlates with increased metastatic disease, reduced patient survival and poor prognosis across multiple tumor types. Despite these well-characterized correlations, the molecular role of vimentin in cancer cell motility remains undefined. To approach

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service