Skip to Content
Merck
CN

EHU059361

MISSION® esiRNA

targeting human GFI1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGACACAAATAGGCTCCTCTACACCTGAAGACAAAGGCAAAGTCAAATGGGGACCAGAATAAATCTTAGACCCCACAGTCCTTCCCATTTCCAGCCCTAATCTACAGACAGGAATGCCCTTCAGGTTTCTTCCCTCCCCCCTCTTGACCTACCCCAGATATTTGTGTGGAAGAGGAGGAATCACCATTTACAAGGTGGACAAATGCTAATATTTTTATCTAGAAAGAAGAGTGAGTGTTAACTTTTATTTTTTTCCTTCTGGGGGGTCTGTTGACTCCTTTCTTTTGGGTGCTGCCTATAAATCTTGGAGGAATCATTTCTCCTCCTCAAAAACTGATTCAGAAACTGACTTGGGGAAGGAATTTAATACTTTGAAGTCATGAGATGCACCATCGAGGCTACCCCCAAGAAGAAGCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongbing Cai et al.
Cancer management and research, 10, 2849-2857 (2018-09-11)
The independent growth factor 1 (Gfi-1) is a transcription factor essential for several diverse hematopoietic functions and developments. However, the role and molecular mechanism of Gfi-1 in the development and progression of cervical cancer remains unclear. The present study investigates
Giacomo Volpe et al.
Scientific reports, 7(1), 11148-11148 (2017-09-13)
Growth Factor Independence 1 (GFI1) is a transcriptional repressor that plays a critical role during both myeloid and lymphoid haematopoietic lineage commitment. Several studies have demonstrated the involvement of GFI1 in haematological malignancies and have suggested that low expression of
Juraj Adamik et al.
Molecular cancer research : MCR, 15(4), 405-417 (2017-01-26)
In multiple myeloma, osteolytic lesions rarely heal because of persistent suppressed osteoblast differentiation resulting in a high fracture risk. Herein, chromatin immunoprecipitation analyses reveal that multiple myeloma cells induce repressive epigenetic histone changes at the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service