Skip to Content
Merck
CN

EHU061891

MISSION® esiRNA

targeting human VTCN1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGACCAGGGAGCCAACTTCTCGGAAGTCTCCAATACCAGCTTTGAGCTGAACTCTGAGAATGTGACCATGAAGGTTGTGTCTGTGCTCTACAATGTTACGATCAACAACACATACTCCTGTATGATTGAAAATGACATTGCCAAAGCAACAGGGGATATCAAAGTGACAGAATCGGAGATCAAAAGGCGGAGTCACCTACAGCTGCTAAACTCAAAGGCTTCTCTGTGTGTCTCTTCTTTCTTTGCCATCAGCTGGGCACTTCTGCCTCTCAGCCCTTACCTGATGCTAAAATAATGTGCCTCGGCCACAAAAAAGCATGCAAAGTCATTGTTACAACAGGGATCTACAGAACTATTTCACCACCAGATATGACCTAGTTTTATATTTCTGGGAGGAAATGAATTCATATCTAGAAGTCTGGAGTGAGCAAACAAGAGCAAGAAACAAAAAGAAGCCAAAAGCAGAAGGCTCCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

wgk

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lijie Dong et al.
Scientific reports, 9(1), 14854-14854 (2019-10-18)
B7-H4, as a member of the B7 superfamily, was overexpressed in various types of cancers. However, the effects of B7-H4 on the aggressiveness of HCC and the underlying mechanisms have not yet been fully explored. For this purpose, B7-H4 expression
Ying Feng et al.
Pathology, research and practice, 218, 153323-153323 (2021-01-12)
B7-H4 is a unique negative regulator of T cells that is typically significantly overexpressed in various carcinomas and is associated with poor prognosis. However, the effects of B7-H4 expression on epithelial-mesenchymal transition (EMT) and cancer stemness of colorectal cancer (CRC)
Xinran Chen et al.
Cancer science, 107(7), 944-954 (2016-04-19)
B7-H4, one of the costimulatory molecules of the B7 family, has been found to be widely expressed in many kinds of tumor tissues and to play an important part in tumor progression and poor prognosis. However, the role of B7-H4
Fu-Biao Kang et al.
Oncotarget, 8(46), 80878-80888 (2017-11-09)
B7-H4, another member of costimulatory molecule, has been shown to be overexpressed in multiple types of tumors, including hepatocellular carcinoma (HCC). However, the specific biological role of B7-H4 in HCC still needs to be further explored. In this study, we
Ling Wang et al.
Cancer cell international, 18, 100-100 (2018-07-17)
The expression of the immunoregulatory protein B7-H4 has been reported in many types of cancer, including breast cancer. However, its role in triple-negative breast cancer (TNBC), especially its correlation with patients' prognosis and chemoresistance remains unclear. The expression of B7-H4

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service