Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAGAAGAATTGCGGAAAGTCTTTATCACTTATTCGATGGACACAGCTATGGAGGTGGTGAAATTCGTGAACTTTTTGTTGGTAAATGGCTTCCAAACTGCAATTGACATATTTGAGGATAGAATCCGAGGCATTGATATCATTAAATGGATGGAGCGCTACCTTAGGGATAAGACCGTGATGATAATCGTAGCAATCAGCCCCAAATACAAACAGGACGTGGAAGGCGCTGAGTCGCAGCTGGACGAGGATGAGCATGGCTTACATACTAAGTACATTCATCGAATGATGCAGATTGAGTTCATAAAACAAGGAAGCATGAATTTCAGATTCATCCCTGTGCTCTTCCCAAATGCTAAGAAGGAGCATGTGCCCACCTGGCTTCAGAACACTCATGTCTACAGCTGGCCCAAGAAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TRAF3IP2(10758)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Nitin A Das et al.
Journal of molecular and cellular cardiology, 121, 107-123 (2018-07-10)
Persistent inflammation promotes development and progression of heart failure (HF). TWEAK (TNF-Related WEAK Inducer Of Apoptosis), a NF-κB- and/or AP-1-responsive proinflammatory cytokine that signals via TWEAK receptor (TWEAKR), is expressed at high levels in human and preclinical models of HF.
Hongxue Sun et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 528-539 (2018-07-19)
This study investigated the role of the microRNA miR-298 and its target Act1 in ischemic stroke. Cell viability was assessed with the 3-(4,5-dimethythiazol-2- yl)-2,5-diphenyl tetrazolium bromide assay. Apoptotic cells were detected by flow cytometry, and mRNA and protein expression were
Hyo Jeong Kim et al.
Biochemical and biophysical research communications, 524(4), 1044-1050 (2020-02-19)
Bone homeostasis is maintained by concerted actions of bone-forming osteoblasts and bone-resorbing osteoclasts. A wide range of evidence indicates that a proinflammatory cytokine IL-17 promotes osteoclastogenesis. However, the role of IL-17 in osteoblasts is less well-understood. In the current study
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU062331-50UG | 04061831372120 |
| EHU062331-20UG | 04061831351002 |