Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGAACCTCCAGAAGCCATCTGGGCAGATGATGTAGATCGCCGGGTGCAATTTGGCATTGAAAGTGGAAAGCTCCGTGGCTTCCTCCGTGTTGGAGACCTGGTGATTGTGGTGACAGGCTGGCGACCTGGCTCCGGCTACACCAACATCATGCGGGTGCTAAGCATATCCTGAGACGCCCCTCCCTCCTCTGGCCCAGCCTACCCTTGTACCCCATCCCTTCCTCCCCAGTCTACGTTCTCCAGCCCACACCCCTCCAAAGCCCCACCTTTAAGTCCTCTCTTCTCTATTCCTGACCCTCCCTACCTGAGGCCTATCTGAGACTATAACTGTCATCTAGCCCCTTCGAGGTTGCCCCTTCCCCATCTCCATTTCACACAGGTCCTGAAAGTCTGTGTCCAATTATGCACTGGCCAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PKLR(5313)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xiaoqiong Duan et al.
Journal of virology, 92(7) (2018-01-13)
Hepatitis C virus (HCV) infection has been shown to regulate microRNA 130a (miR-130a) in patient biopsy specimens and in cultured cells. We sought to identify miR-130a target genes and to explore the mechanisms by which miR-130a regulates HCV and hepatitis
Stephanie Dabo et al.
Scientific reports, 7(1), 16129-16129 (2017-11-25)
PKR is a cellular kinase involved in the regulation of the integrative stress response (ISR) and pro-inflammatory pathways. Two N-terminal dsRNA Binding Domains (DRBD) are required for activation of PKR, by interaction with either dsRNA or PACT, another cellular DRBD-containing
D C Tanner et al.
Cell death and differentiation, 22(9), 1489-1501 (2015-01-31)
Neuroinflammation associated with degenerative central nervous system disease and injury frequently results in oligodendrocyte death. While promoting oligodendrocyte viability is a major therapeutic goal, little is known about protective signaling strategies. We report that in highly purified rat oligodendrocytes, interferon
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU064181-20UG | 04061828606993 |
| EHU064181-50UG | 04061828381876 |