Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GATGGTCCCCTTCCTCTACCATACAGGCACTATATTGCAATAATGGCTGCAGCTAGACATCAGTGTTCTTACTTAATAAACATGCATGTGGATGAATTTTTAAAGACTGGAGGTATTGCTGAGTGGTTGAATGGTTTGGAATATGTGCCACAAAGACTGAAAAATCTTAATGAAATTAATAAGCTGCTAGCACATCGACCTTGGCTGATCACAAAAGAGCACATTCAGAAACTTGTCAAAACTGGAGAAAATAATTGGTCTCTGCCTGAACTGGTACATGCTGTGGTCCTCCTGGCACATTATCATGCTTTGGCAAGCTTTGTTTTTGGTAGTGGTATCAATCCAGAGAGAGATCCAGAAATCTCCAATGGATTCAGGCTAATATCAGTCAACAATTTCTGCGTTTGTGATCTTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SESN3(143686)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yasuo Miki et al.
Neuroscience letters, 684, 35-41 (2018-07-04)
Neurodegenerative disorders such as Parkinson's disease (PD) and dementia with Lewy bodies (DLB) are characterized by impairment of autophagy. Cellular survival is dependent on efficient clearance of phosphorylated α-synuclein, which accumulates as fibrils in the neuronal cytoplasm as Lewy bodies
Liuqing Ge et al.
International immunology, 32(6), 421-432 (2020-03-11)
Intestinal macrophages participate in the pathogenesis of inflammatory bowel diseases (IBDs) through secreting pro-inflammatory and tissue-damaging factors as well as inducing the differentiation of T helper 1 (Th1) and T helper 17 (Th17) cells. Elucidating the regulatory mechanisms of intestinal
Russell E Ericksen et al.
Cell metabolism, 29(5), 1151-1165 (2019-01-22)
Tumors display profound changes in cellular metabolism, yet how these changes aid the development and growth of tumors is not fully understood. Here we use a multi-omic approach to examine liver carcinogenesis and regeneration, and find that progressive loss of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU064421-20UG | 04061828607167 |
| EHU064421-50UG | 04061828382088 |