Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGGTCTTTCAGCCACCATTGCTAGGAGTGAGCATGAGATTTCTGAAATTATTGATGGGCTCTCTGAGCAGGAGAATAATGAGAAACAAATGCGGCAGCTCTCTGTGATTCCACCTATGATGTTTGATGCAGAACAAAGACGAGTCAAGTTCATTAACATGAATGGGCTTATGGAGGACCCTATGAAAGTGTATAAAGATAGGCAGTTTATGAATGTTTGGACTGACCATGAAAAGGAGATCTTTAAGGACAAGTTTATCCAGCATCCAAAAAACTTTGGACTAATTGCATCATACTTGGAGAGGAAGAGTGTTCCTGATTGTGTTTTGTATTACTATTTAACCAAGAAAAATGAGAATTATAAAGCCCTCGTCAGAAGGAATTATGGGAAACGCAGAGGCAGAAACCAGCAAAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NCOR1(9611)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lu Tang et al.
FEBS open bio, 10(12), 2678-2686 (2020-10-16)
Prostate cancer (PCa) is the most frequently diagnosed male cancer. An earlier study of a cohort of 333 primary prostate carcinomas showed that 74% of these tumors fell into one of seven subtypes of a molecular taxonomy defined by specific
Ying Lu et al.
PloS one, 8(11), e79815-e79815 (2013-11-22)
Rosiglitazone (RGL), a synthetic agonist for peroxisome proliferator activated receptor γ (PPARγ), exhibits a potent anti-inflammatory activity by attenuating local infiltration of neutrophils and monocytes in the renal interstitium. To evaluate the mechanisms that account for inhibiting inflammatory cells infiltration
Jung-Yoon Yoo et al.
Oncotarget, 4(7), 972-983 (2013-05-15)
The aberrant expressions of casein kinase 2 (CK2) was found in prostate cancer patient and cell lines, but little is known of the detailed mechanisms implicated in prostate tumorigenesis. In this study, we report that both CK2 activity and CK2-mediated
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU065611-50UG | 04061831372359 |
| EHU065611-20UG | 04061828615926 |