Skip to Content
Merck
CN

EHU065681

MISSION® esiRNA

targeting human ATP8A2

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTCATGGAGCCTGGAGCTACAACCGGGTGACCAAGTGCATCTTGTACTGCTTCTATAAGAACGTGGTCCTGTATATTATTGAGCTTTGGTTCGCCTTTGTTAATGGATTTTCTGGGCAGATTTTATTTGAACGTTGGTGCATCGGCCTGTACAATGTGATTTTCACCGCTTTGCCGCCCTTCACTCTGGGAATCTTTGAGAGGTCTTGCACTCAGGAGAGCATGCTCAGGTTTCCCCAGCTCTACAAAATCACCCAGAATGGCGAAGGCTTCAACACAAAGGTTTTCTGGGGTCACTGCATCAACGCCTTGGTCCACTCCCTCATCCTCTTCTGGTTTCCCATGAAAGCTCTGGAGCATGATACTGTGTTGACAAGTGGTCATGCTACCGACTATTTATTTGTTGGAAATATTGTTTACACATATGTTGTTGTTACTGTTTGTCTGAAAGCTGGTTTGGAGACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

A Dorronsoro et al.
Cell death & disease, 4, e972-e972 (2013-12-21)
The zinc-finger protein A20 is a key player in the negative feedback regulation of the nuclear factor kappa-light-chain-enhancer of activated B-cell (NF-κB) pathway in response to multiple stimuli. Tumor necrosis factor alpha (TNFα), a cytokine with pleiotropic effects on cellular
Kerstin Boengler et al.
Basic research in cardiology, 105(6), 771-785 (2010-10-21)
The signal transducer and activator of transcription 3 (STAT3) contributes to cardioprotection by ischemic pre- and postconditioning. Mitochondria are central elements of cardioprotective signaling, most likely by delaying mitochondrial permeability transition pore (MPTP) opening, and STAT3 has recently been identified
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service