Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTTTACGTGTGTGGGACCAACGCATTCCAGCCGGCCTGTGACCACCTGAACTTAACATCCTTTAAGTTTCTGGGGAAAAATGAAGATGGCAAAGGAAGATGTCCCTTTGACCCAGCACACAGCTACACATCCGTCATGGTTGATGGAGAACTTTATTCGGGGACGTCGTATAATTTTTTGGGAAGTGAACCCATCATCTCCCGAAATTCTTCCCACAGTCCTCTGAGGACAGAATATGCAATCCCTTGGCTGAACGAGCCTAGTTTCGTGTTTGCTGACGTGATCCGAAAAAGCCCAGACAGCCCCGACGGCGAGGATGACAGGGTCTACTTCTTCTTCACGGAGGTGTCTGTGGAGTATGAGTTTGTGTTCAGGGTGCTGATCCCACGGATAGCAAGAGTGTGCAAGGGGGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SEMA4D(10507)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Nicole Heitzig et al.
Cell adhesion & migration, 11(3), 275-287 (2017-01-07)
The physiological and pathological process of angiogenesis relies on orchestrated endothelial cell (EC) adhesion, migration and formation of new vessels. Here we report that human umbilical vein endothelial cells (HUVECs) deficient in Annexin A8 (AnxA8), a member of the annexin
Golnaz Rashidi et al.
Molecular biology reports, 47(9), 7017-7027 (2020-09-06)
Overexpression of semaphorin 4D (SEMA4D), an immune semaphorin, is found in various human malignancies, including colorectal cancer (CRC). In this study, we explored the relationship between silencing SEMA4D expression and 5-fluorouracil (5-FU) response in the colorectal cancer cell line. SW48
Katharina Lueck et al.
Scientific reports, 7(1), 4638-4638 (2017-07-07)
The retinoic acid derivative fenretinide (FR) is capable of transdifferentiating cultured retinal pigment epithelial (RPE) cells towards a neuronal-like phenotype, but the underlying mechanisms are not understood. To identify genes involved in this process we performed a microarray analysis of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU066521-20UG | 04061828616749 |
| EHU066521-50UG | 04061828384044 |