Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAAAGATATTCGCCAGGAGTATCGAGAGGACTTTGTGCTCACCGTGACTGGCAAGAAGCACCCGTGCTGTGTCTTATCCAATCCCGACCAGAAGGGTAAGATTAGGAGAATCGACTGCCTGCGACAGGCAGACAAAGTCTGGCGTCTGGATCTAGTCATGGTGATCCTGTTCAAAGGCATCCCCTTGGAAAGTACCGATGGAGAGCGGCTCATGAAATCCCCACATTGCACAAACCCAGCACTTTGTGTCCAGCCACATCATATCACAGTATCAGTTAAGGAGCTTGATTTGTTTTTGGCATACTACGTGCAGGAGCAAGATTCTGGACAATCAGGAAGTCCAAGCCACAATGATCCTGCCAAGAATCCTCCAGGTTACCTTGAGGATAGTTTTGTAAAATCTGGAGTCTTCAATGTATCAGAACTTGTAAGAGTATCCAGAACGCCCATAACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NFIB(4781)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Q-Y Liu et al.
European review for medical and pharmacological sciences, 24(13), 7266-7275 (2020-07-25)
Long non-coding RNAs (lncRNAs) have been found to exert specific functions in the progression of ovarian cancer (OC), except for lncRNA-OIP5-AS1. In this study, we aim at exploring the molecular mechanisms of OIP5-AS1 in OC. The expression levels of OIP5-AS1
Jing Chen et al.
Viruses, 7(10), 5539-5552 (2015-10-30)
Porcine reproductive and respiratory syndrome virus (PRRSV) infection strongly modulates the host's immune response. The RNA silencing pathway is an intracellular innate response to viral infections. However, it is unknown whether PRRSV interacts with cellular RNA silencing to facilitate the
Anna Yu-Szu Huang et al.
Neuron, 106(6), 992-1008 (2020-04-23)
Astrocytes play essential roles in brain function by supporting synaptic connectivity and associated circuits. How these roles are regulated by transcription factors is unknown. Moreover, there is emerging evidence that astrocytes exhibit regional heterogeneity, and the mechanisms controlling this diversity
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU070441-50UG | 04061828370467 |
| EHU070441-20UG | 04061828610136 |