Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCGACCACATCCACCTCATCAGCGTGGGCGACATGATCGAGGCCATTAACGGGCAGAGCCTGCTGGGCTGCCGGCACTACGAGGTGGCCCGGCTGCTCAAGGAGCTGCCCCGAGGCCGTACCTTCACGCTGAAGCTCACGGAGCCTCGCAAGGCCTTCGACATGATCAGCCAGCGTTCAGCGGGTGGCCGCCCTGGCTCTGGCCCACAACTGGGCACTGGCCGAGGGACCCTGCGGCTCCGATCCCGGGGCCCCGCCACGGTGGAGGATCTGCCCTCTGCCTTTGAAGAGAAGGCCATTGAGAAGGTGGATGACCTGCTGGAGAGTTACATGGGTATCAGGGACACGGAGCTGGCGGCCACCATGGTGGAGCTGGGAAAGGACAAAAGGAACCCGGATGAGCTGGCCGAGGCCCTGGACGAACGGCTGGGTGACTTTGCCTTCCCTGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GIPC1(10755)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Guilong Zhang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13777-13788 (2016-08-03)
Glioma occurs due to multi-gene abnormalities. Neuropilin-1 (NRP-1), as a transmembrane protein, involves in glioma proliferation, invasion, and migration, as well as tumor angiogenesis. The cytoplasmic protein, GAIP/RGS19-interacting protein (GIPC1), could regulate the clathrin-vesicles trafficking and recycling. Here, we show
Ling Wang et al.
PloS one, 2(11), e1161-e1161 (2007-11-15)
Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF), one of the crucial pro-angiogenic factors, functions as a potent inhibitor of endothelial cell (EC) apoptosis. Previous progress has been made towards delineating the VPF/VEGF survival signaling downstream of the activation of VEGFR-2.
Xiuping Huang et al.
Nature communications, 10(1), 3708-3708 (2019-08-20)
Neuropilin-1 (NRP1) is an essential transmembrane receptor with a variety of cellular functions. Here, we identify two human NRP1 splice variants resulting from the skipping of exon 4 and 5, respectively, in colorectal cancer (CRC). Both NRP1 variants exhibit increased
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU072801-20UG | 04061828612123 |
| EHU072801-50UG | 04061828372676 |