Skip to Content
Merck
CN

EHU072801

Sigma-Aldrich

MISSION® esiRNA

targeting human GIPC1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCGACCACATCCACCTCATCAGCGTGGGCGACATGATCGAGGCCATTAACGGGCAGAGCCTGCTGGGCTGCCGGCACTACGAGGTGGCCCGGCTGCTCAAGGAGCTGCCCCGAGGCCGTACCTTCACGCTGAAGCTCACGGAGCCTCGCAAGGCCTTCGACATGATCAGCCAGCGTTCAGCGGGTGGCCGCCCTGGCTCTGGCCCACAACTGGGCACTGGCCGAGGGACCCTGCGGCTCCGATCCCGGGGCCCCGCCACGGTGGAGGATCTGCCCTCTGCCTTTGAAGAGAAGGCCATTGAGAAGGTGGATGACCTGCTGGAGAGTTACATGGGTATCAGGGACACGGAGCTGGCGGCCACCATGGTGGAGCTGGGAAAGGACAAAAGGAACCCGGATGAGCTGGCCGAGGCCCTGGACGAACGGCTGGGTGACTTTGCCTTCCCTGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guilong Zhang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13777-13788 (2016-08-03)
Glioma occurs due to multi-gene abnormalities. Neuropilin-1 (NRP-1), as a transmembrane protein, involves in glioma proliferation, invasion, and migration, as well as tumor angiogenesis. The cytoplasmic protein, GAIP/RGS19-interacting protein (GIPC1), could regulate the clathrin-vesicles trafficking and recycling. Here, we show
Ling Wang et al.
PloS one, 2(11), e1161-e1161 (2007-11-15)
Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF), one of the crucial pro-angiogenic factors, functions as a potent inhibitor of endothelial cell (EC) apoptosis. Previous progress has been made towards delineating the VPF/VEGF survival signaling downstream of the activation of VEGFR-2.
Xiuping Huang et al.
Nature communications, 10(1), 3708-3708 (2019-08-20)
Neuropilin-1 (NRP1) is an essential transmembrane receptor with a variety of cellular functions. Here, we identify two human NRP1 splice variants resulting from the skipping of exon 4 and 5, respectively, in colorectal cancer (CRC). Both NRP1 variants exhibit increased
Ayumi Yoshida et al.
Biology open, 4(9), 1063-1076 (2015-07-26)
Neuropilin-1 (NRP1) has been identified as a VEGF-A receptor. DJM-1, a human skin cancer cell line, expresses endogenous VEGF-A and NRP1. In the present study, the RNA interference of VEGF-A or NRP1 suppressed DJM-1 cell proliferation. Furthermore, the overexpression of
Santanu Bhattacharya et al.
PloS one, 9(12), e114409-e114409 (2014-12-04)
GAIP interacting protein C terminus (GIPC) is known to play an important role in a variety of physiological and disease states. In the present study, we have identified a novel role for GIPC as a master regulator of autophagy and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service