Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AATGTGGGCTGTTCTTGAGCTAGGTGCTGAGACAGGTGTGCAAAGTTCTGACCTTCAGTGGATGAGAAATGTCATCAGAATGATGCCCCTGATAACCTTGCCCATAACCATGCATTTCCCCACGGCAGTGTTTATGTACTGGCTCTCCTCCAATTTGTTTTCCCTGGTCCAAGTATCCTGTCTCCGGATTCCAGCAGTACGCACTGTACTTAAAATCCCCCAGCGTGTTGTACATGACCTGGACAAATTACCTCCACGGGAAGGCTTCCTAGAGAGCTTCAAAAAAGGCTGGAAAAATGCTGAAATGACGCGTCAGCTGCGAGAGCGTGAACAACGCATGCGGAATCAGTTGGAGCTAGCAGCCAGGGGTCCTTTACGACAGACCTTTACCCACAACCCTCTCCTACAACCTGGAAAGGATAACCCTCCCAATATCCCTAGCAGCAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... OXA1L(5018)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hongfei Chen et al.
Bioengineered, 11(1), 1269-1279 (2020-11-04)
Emerging evidence suggested that circular RNAs (circRNAs) play critical roles in cervical cancer (CC) progression. However, the roles and molecular mechanisms of hsa_circ_0007364 in the tumorigenesis of CC remain unclear. In the present study, we used bioinformatics analysis and a
Yuhan Chen et al.
Gene, 629, 35-42 (2017-08-05)
Radiation-induced liver fibrosis (RILF) is considered as a major complication of radiation therapy for liver cancer. Circular RNA (circRNA) has been recently identified as a functional noncoding RNA involving in various biological processes. However, the expression pattern and regulatory capacity
Beibei Shao et al.
Biochemical and biophysical research communications, 513(1), 135-140 (2019-04-05)
Recent studies indicated that circular RNAs (circRNAs) could play critical roles in the initiation and development of tumors, including tongue squamous cell carcinoma (TSCC). We aimed to investigate the roles and underlying mechanisms of hsa_circ_0001742 in TSCC. In the present
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU074341-50UG | 04061828400829 |
| EHU074341-20UG | 04061831353020 |