Skip to Content
Merck
CN

EHU074341

MISSION® esiRNA

targeting human OXA1L

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGTGGGCTGTTCTTGAGCTAGGTGCTGAGACAGGTGTGCAAAGTTCTGACCTTCAGTGGATGAGAAATGTCATCAGAATGATGCCCCTGATAACCTTGCCCATAACCATGCATTTCCCCACGGCAGTGTTTATGTACTGGCTCTCCTCCAATTTGTTTTCCCTGGTCCAAGTATCCTGTCTCCGGATTCCAGCAGTACGCACTGTACTTAAAATCCCCCAGCGTGTTGTACATGACCTGGACAAATTACCTCCACGGGAAGGCTTCCTAGAGAGCTTCAAAAAAGGCTGGAAAAATGCTGAAATGACGCGTCAGCTGCGAGAGCGTGAACAACGCATGCGGAATCAGTTGGAGCTAGCAGCCAGGGGTCCTTTACGACAGACCTTTACCCACAACCCTCTCCTACAACCTGGAAAGGATAACCCTCCCAATATCCCTAGCAGCAGC

Ensembl | human accession no.

ENSG00000155463

NCBI accession no.

NM_005015

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
TVT
QCS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongfei Chen et al.
Bioengineered, 11(1), 1269-1279 (2020-11-04)
Emerging evidence suggested that circular RNAs (circRNAs) play critical roles in cervical cancer (CC) progression. However, the roles and molecular mechanisms of hsa_circ_0007364 in the tumorigenesis of CC remain unclear. In the present study, we used bioinformatics analysis and a
F-J Huang et al.
European review for medical and pharmacological sciences, 24(4), 1887-1898 (2020-03-07)
Breast cancer (BC) is the second most frequent malignancy worldwide. Hsa_circ_0008039 exerts the carcinogenic factors in BC. However, the pathogenesis of hsa_circ_0008039 involved in BC is still unclear. The expression levels of hsa_circ_0008039, microRNA-515-5p (miR-515-5p) and chromobox homolog 4 (CBX4)
Yuhan Chen et al.
Gene, 629, 35-42 (2017-08-05)
Radiation-induced liver fibrosis (RILF) is considered as a major complication of radiation therapy for liver cancer. Circular RNA (circRNA) has been recently identified as a functional noncoding RNA involving in various biological processes. However, the expression pattern and regulatory capacity
Beibei Shao et al.
Biochemical and biophysical research communications, 513(1), 135-140 (2019-04-05)
Recent studies indicated that circular RNAs (circRNAs) could play critical roles in the initiation and development of tumors, including tongue squamous cell carcinoma (TSCC). We aimed to investigate the roles and underlying mechanisms of hsa_circ_0001742 in TSCC. In the present
Wei Liu et al.
Biochemical and biophysical research communications, 500(4), 846-851 (2018-04-27)
Lung cancer characterized with malignant cell growth is the leading cause of cancer-related deaths. In recent years, several circular RNAs (circRNAs) have been reported to participate in lung cancer progression. However, the correlation between circular RNA (circRNA) and lung cancer still
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service