Skip to Content
Merck
CN

EHU075001

Sigma-Aldrich

MISSION® esiRNA

targeting human PBRM1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCCTCAGTGCCATATTTCTGAGGCTTCCCTCTAGATCTGAGTTGCCTGACTACTATCTGACTATTAAAAAGCCCATGGACATGGAAAAAATTCGAAGTCACATGATGGCCAACAAGTACCAAGATATTGACTCTATGGTTGAGGACTTTGTCATGATGTTTAATAATGCCTGTACATACAATGAGCCGGAGTCTTTGATCTACAAAGATGCTCTTGTTCTACACAAAGTCCTGCTTGAAACACGCAGAGACCTGGAGGGAGATGAGGACTCTCATGTCCCAAATGTGACTTTGCTGATTCAAGAGCTTATCCACAATCTTTTTGTGTCAGTCATGAGTCATCAGGATGATGAGGGAAGATGCTACAGCGATTCTTTAGCAGAAATTCCTGCTGTGGATCCCAACTTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Atsuko Niimi et al.
Nucleic acids research, 40(15), 7393-7403 (2012-05-29)
In eukaryotic cells, replication past damaged sites in DNA is regulated by the ubiquitination of proliferating cell nuclear antigen (PCNA). Little is known about how this process is affected by chromatin structure. There are two isoforms of the Remodels the
Xian-De Liu et al.
Nature communications, 11(1), 2135-2135 (2020-05-03)
A non-immunogenic tumor microenvironment (TME) is a significant barrier to immune checkpoint blockade (ICB) response. The impact of Polybromo-1 (PBRM1) on TME and response to ICB in renal cell carcinoma (RCC) remains to be resolved. Here we show that PBRM1/Pbrm1
Tianjie Liu et al.
Aging, 12(21), 21809-21836 (2020-11-13)
We investigated the mechanisms affecting tumor progression and survival outcomes in Polybromo-1-mutated (PBRM1MUT) clear cell renal cell carcinoma (ccRCC) patients. PBRM1MUT ccRCC tissues contained higher numbers of mast cells and lower numbers of CD8+ and CD4+ T cells than tissues

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service