Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCCTCAGTGCCATATTTCTGAGGCTTCCCTCTAGATCTGAGTTGCCTGACTACTATCTGACTATTAAAAAGCCCATGGACATGGAAAAAATTCGAAGTCACATGATGGCCAACAAGTACCAAGATATTGACTCTATGGTTGAGGACTTTGTCATGATGTTTAATAATGCCTGTACATACAATGAGCCGGAGTCTTTGATCTACAAAGATGCTCTTGTTCTACACAAAGTCCTGCTTGAAACACGCAGAGACCTGGAGGGAGATGAGGACTCTCATGTCCCAAATGTGACTTTGCTGATTCAAGAGCTTATCCACAATCTTTTTGTGTCAGTCATGAGTCATCAGGATGATGAGGGAAGATGCTACAGCGATTCTTTAGCAGAAATTCCTGCTGTGGATCCCAACTTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PBRM1(55193)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Atsuko Niimi et al.
Nucleic acids research, 40(15), 7393-7403 (2012-05-29)
In eukaryotic cells, replication past damaged sites in DNA is regulated by the ubiquitination of proliferating cell nuclear antigen (PCNA). Little is known about how this process is affected by chromatin structure. There are two isoforms of the Remodels the
Xian-De Liu et al.
Nature communications, 11(1), 2135-2135 (2020-05-03)
A non-immunogenic tumor microenvironment (TME) is a significant barrier to immune checkpoint blockade (ICB) response. The impact of Polybromo-1 (PBRM1) on TME and response to ICB in renal cell carcinoma (RCC) remains to be resolved. Here we show that PBRM1/Pbrm1
Tianjie Liu et al.
Aging, 12(21), 21809-21836 (2020-11-13)
We investigated the mechanisms affecting tumor progression and survival outcomes in Polybromo-1-mutated (PBRM1MUT) clear cell renal cell carcinoma (ccRCC) patients. PBRM1MUT ccRCC tissues contained higher numbers of mast cells and lower numbers of CD8+ and CD4+ T cells than tissues
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU075001-20UG | 04061828617593 |
| EHU075001-50UG | 04061828391806 |