Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCTTTTGCAATCAGCATTTGGATCTCAGAATGAGCAAGGAAAGACCCAAGAGGAATATCATTCAGAAGAAATACGATGACAGTGATGGGATTCCGTGGTCAGAAGAACGGGTGGTACGTAAAGTCCTTTATTTGTCTCTGAAGGAGTTCAAGAATTCCCAGAAGAGGCAGCATGCGGAAGGCATTGCTGGGAGCCTGAAAACTGTGAATGGGCTCCTTGGTAATGACCAGTCTAAGGGATTAGGACCAGCATCAGAACAGTCAGAGAATGAAAAGGACGATGCATCCCAAGTGTCCTCCACTAGCAACGATGTTAGTTCTTCAGATTTTGAAGAAGGGCCGTCGAGGAAAAGGCCCAGGCTGCAAGCACAAAGGAAGTTTGCTCAGTCTCAGCCGAATAGTCCCAGCACAACTCCAGTAAAGATAGTGGAGCCATTGCTACCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... JARID2(3720)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
常规特殊物品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Diaa Al-Raawi et al.
The EMBO journal, 38(3) (2018-12-24)
Polycomb repressive complex-2 (PRC2) is a group of proteins that play an important role during development and in cell differentiation. PRC2 is a histone-modifying complex that catalyses methylation of lysine 27 of histone H3 (H3K27me3) at differentiation genes leading to
Dandan Liang et al.
International journal of cardiology, 201, 38-48 (2015-08-25)
In mammals, the heart grows by hypertrophy but not proliferation of cardiomyocytes after birth. The paucity of cardiomyocyte proliferation limits cardiac regeneration in a variety of heart diseases. To explore the efficient strategies that drive cardiomyocyte proliferation, we employed in
Chang-Liang Su et al.
International journal of hematology, 102(1), 76-85 (2015-05-06)
It has recently been shown that JARID2 contributes to the malignant character of solid tumors, such as epithelial-mesenchymal transition in lung and colon cancer cell lines, but its role in leukemia progression is unexplored. In this study, we explored the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU076641-50UG | 04061828393336 |
| EHU076641-20UG | 04061831353457 |