Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACACACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTACCTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAACAAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAGTCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACACGTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGCGCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGCCCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ZBTB20(26137)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
An-Jing Ren et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(10), 13862-13876 (2020-08-28)
The zinc-finger protein ZBTB20 regulates development and metabolism in multiple systems, and is essential for postnatal survival in mice. However, its potential role in the cardiovascular system remains undefined. Here, we demonstrate that ZBTB20 is critically involved in the regulation
Liuyang Wang et al.
Cell host & microbe, 24(2), 308-323 (2018-08-10)
Pathogens have been a strong driving force for natural selection. Therefore, understanding how human genetic differences impact infection-related cellular traits can mechanistically link genetic variation to disease susceptibility. Here we report the Hi-HOST Phenome Project (H2P2): a catalog of cellular
Ji Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(5), 2074-2083 (2018-08-14)
To determine the cellular functions and clinical significance of micro-758-5p (miR-758-5p) in glioblastoma (GBM) by targeting zinc finger and BTB domain-containing protein 20 (ZBTB20). Fifty-five paired GBM tissues and adjacent normal tissues, GBM cell lines (U118, LN-299, H4, A172, U87-MG
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU077821-20UG | 04061831363098 |
| EHU077821-50UG | 04061828401314 |