Skip to Content
Merck
CN

EHU077821

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB20

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACACACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTACCTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAACAAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAGTCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACACGTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGCGCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGCCCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liuyang Wang et al.
Cell host & microbe, 24(2), 308-323 (2018-08-10)
Pathogens have been a strong driving force for natural selection. Therefore, understanding how human genetic differences impact infection-related cellular traits can mechanistically link genetic variation to disease susceptibility. Here we report the Hi-HOST Phenome Project (H2P2): a catalog of cellular
Ji Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(5), 2074-2083 (2018-08-14)
To determine the cellular functions and clinical significance of micro-758-5p (miR-758-5p) in glioblastoma (GBM) by targeting zinc finger and BTB domain-containing protein 20 (ZBTB20). Fifty-five paired GBM tissues and adjacent normal tissues, GBM cell lines (U118, LN-299, H4, A172, U87-MG
An-Jing Ren et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(10), 13862-13876 (2020-08-28)
The zinc-finger protein ZBTB20 regulates development and metabolism in multiple systems, and is essential for postnatal survival in mice. However, its potential role in the cardiovascular system remains undefined. Here, we demonstrate that ZBTB20 is critically involved in the regulation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service