Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGATTTCGATGGGGTCCTCTATCATATTTCAAATCCTAATGGAGACAAAACAAAAGTGATGGTCAGTATTTCTTTGAAATTCTACAAGGAACTTCAGGCACATGGTGCTGATGAGTTATTAAAGAGGGTGTACGGGAGTTTCTTGGTAAATCCAGAATCAGGATACAATGTCTCTTTGCTATATGACCTTGAAAATCTTCCGGCATCCAAGGATTCCATTGTGCATCAAGCTGGCATGTTGAAGCGAAATTGTTTTGCCTCTGTCTTTGAAAAATACTTCCAATTCCAAGAAGAGGGCAAGGAAGGAGAGAACAGGGCAGTTATCCATTATAGGGATGATGAGACCATGTATGTTGAGTCTAAAAAGGACAGAGTCACAGTAGTCTTCAGCACAGTGTTTAAGGATGACGACGATGTGGTCATTGGAAAGGTGTTCATGCAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ARPC2(10109)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Zhongle Cheng et al.
Oncology reports, 41(6), 3189-3200 (2019-04-20)
Actin-related protein 2/3 complex (ARPC2) is an actin‑binding component involved in the regulation of actin polymerization. It mediates the formation of branched actin networks and contacts the mother actin filament. Migration and invasion are key processes which enable tumor cells
Yae Jin Yoon et al.
Biochemical pharmacology, 163, 46-59 (2019-02-03)
Metastasis is the leading cause of cancer mortality and cancer cell migration is an essential stage of metastasis. We identified benproperine (Benp, a clinically used antitussive drug) as an inhibitor of cancer cell migration and an anti-metastatic agent. Benp selectively
Aleksandra S Chikina et al.
Biology of the cell, 111(10), 245-261 (2019-08-14)
Metastatic disease is caused by the ability of cancer cells to reach distant organs and form secondary lesions at new locations. Dissemination of cancer cells depends on their migration plasticity - an ability to switch between motility modes driven by
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU077951-50UG | 04061831373219 |
| EHU077951-20UG | 04061828629053 |