Skip to Content
Merck
CN

EHU081301

Sigma-Aldrich

MISSION® esiRNA

targeting human RACGAP1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGTCATTGTTGGGAGCTTTTAGATGAGACATCTTTCCAGGGGTAGAAGGGTTAGTATGGAATTGGTTGTGATTCTTTTTGGGGAAGGGGGTTATTGTTCCTTTGGCTTAAAGCCAAATGCTGCTCATAGAATGATCTTTCTCTAGTTTCATTTAGAACTGATTTCCGTGAGACAATGACAGAAACCCTACCTATCTGATAAGATTAGCTTGTCTCAGGGTGGGAAGTGGGAGGGCAGGGCAAAGAAAGGATTAGACCAGAGGATTTAGGATGCCTCCTTCTAAGAACCAGAAGTTCTCATTCCCCATTATGAACTGAGCTATAATATGGAGCTTTCATAAAAATGGGATGCATTGAGGACAGAACTAGTGATGGGAGTATGCGTAGCTTTGATTTGGATGATTAGGTCTTTAATAGTGTTGAGTGGCACAACCTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Toshiyuki Kawashima et al.
The Journal of cell biology, 175(6), 937-946 (2006-12-21)
STAT transcription factors are tyrosine phosphorylated upon cytokine stimulation and enter the nucleus to activate target genes. We show that Rac1 and a GTPase-activating protein, MgcRacGAP, bind directly to p-STAT5A and are required to promote its nuclear translocation. Using permeabilized
Matthew L Kutys et al.
Nature cell biology, 16(9), 909-917 (2014-08-26)
Rho-family GTPases govern distinct types of cell migration on different extracellular matrix proteins in tissue culture or three-dimensional (3D) matrices. We searched for mechanisms selectively regulating 3D cell migration in different matrix environments and discovered a form of Cdc42-RhoA crosstalk
Xinchun Ding et al.
Oncotarget, 8(18), 30123-30137 (2017-04-19)
Lysosomal acid lipase (LAL) is a critical neutral lipid metabolic enzyme that regulates metabolic reprogramming in myeloid-derived suppressor cells (MDSCs) through over-activation of mammalian target of rapamycin (mTOR). Affymetrix GeneChip microarray analysis of MDSCs from LAL deficient mouse (lal-/-) revealed
Arjan J van Adrichem et al.
FEBS letters, 589(24 Pt B), 3859-3865 (2015-11-26)
Male germ cell Rac GTPase-activating protein (MgcRacGAP) is a core regulator of cytokinesis. Furthermore, it appears to be involved in human oncogenesis through cytokinesis-independent mechanisms and has been reported to be essential for nuclear translocation of signal transducer and activator

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service