Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TACACTGCCTGTCGCTTGTCTTCTATTCACCATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... STMN1(3925)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Pinjie Bao et al.
Annals of surgical oncology, 24(13), 4017-4024 (2017-09-22)
Known as a microtubule-destabilizing protein, STMN1 (gene symbol: STMN1) regulates the dynamics of microtubules, cell cycle progress, and chemo-resistance against taxane agents. It is highly expressed in various human cancers and involved in cancer progression as well as poor prognosis.
C M Fife et al.
Oncogene, 36(4), 501-511 (2016-06-21)
Neuroblastoma, the most common solid tumor of young children, frequently presents with aggressive metastatic disease and for these children the 5-year survival rates are dismal. Metastasis, the movement of cancer cells from one site to another, involves remodeling of the
Deepmala Shrestha et al.
Journal of cellular biochemistry, 119(2), 2381-2395 (2017-09-09)
Stathmin/oncoprotein18 regulates microtubule dynamics and participates in mitotic entry and exit. We isolated stathmin as a physically interacting partner of KIFC1, a minus-end-directed kinesin functioning in bipolar spindle formation and maintenance. We found that stathmin depletion leads to multipolar spindle
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU084551-50UG | 04061828396252 |
| EHU084551-20UG | 04061831354553 |