Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGCCATCAAATGTGGAACCTATGGAAAAGGAGTTTGGGCTTTGCAAAACTGAGAACAAAGCCAAGTCGGGCAAACAGAATTCAAAGAAGCTGTACTGCCAAGAACTTAAAAAGGTGATTGAAGCCTCCGATGTTGTCCTAGAGGTGTTGGATGCCAGAGATCCTCTTGGTTGCAGATGTCCTCAGGTAGAAGAGGCCATTGTCCAGAGTGGACAGAAAAAGCTGGTACTTATATTAAATAAATCAGATCTGGTACCAAAGGAGAATTTGGAGAGCTGGCTAAATTATTTGAAGAAAGAATTGCCAACAGTGGTGTTCAGAGCCTCAACAAAACCAAAGGATAAAGGGAAGATAACCAAGCGTGTGAAGGCAAAGAAGAATGCTGCTCCATTCAGAAGTGAAGTCTGCTTTGGGAAAGAGGGCCTTTGGAAAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GNL3(26354)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mei-Hong Li et al.
Journal of pediatric surgery, 49(8), 1286-1291 (2014-08-06)
Neuroblastoma (NB) is the most common extracranial solid tumor of childhood. Preliminary data derived from a human angiogenesis array in NB showed that the bioactive lipid sphingosine-1-phosphate (S1P) induced the secretion of several angiogenesis-related proteins including the important inflammatory factor
Tengwei Cao et al.
PloS one, 9(8), e103793-e103793 (2014-08-08)
Atrial hypertrophy and fibrosis are essential pathological features of atrial fibrillation. Recently, adiponectin has become a protein of interest due to its beneficial effects on cardiovascular diseases. However, the molecular mechanism of atrial structural remodeling and signaling pathways evoked by
Zhihong Yuan et al.
PloS one, 9(5), e94241-e94241 (2014-05-21)
It is increasingly recognized that the tumor microenvironment plays a critical role in the initiation and progression of lung cancer. In particular interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment has been shown to facilitate cancer
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU085631-50UG | 04061828387748 |
| EHU085631-20UG | 04061828621163 |