Skip to Content
Merck
CN

EHU087641

MISSION® esiRNA

targeting human TLN1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTTTGGTTGCCTGGACAGTGTAATGGAGAACTCAAAGGTGCTGGGCGAGGCCATGACTGGCATCTCCCAAAATGCCAAGAACGGAAACCTGCCAGAGTTTGGAGATGCCATTTCCACAGCCTCAAAGGCACTTTGTGGCTTCACCGAGGCAGCTGCACAGGCTGCATATCTGGTTGGTGTCTCTGACCCCAATAGCCAAGCTGGACAGCAAGGGCTAGTGGAGCCCACACAGTTTGCCCGTGCAAACCAGGCAATTCAGATGGCCTGCCAGAGTTTGGGAGAGCCTGGCTGTACCCAGGCCCAGGTGCTCTCTGCAGCCACCATTGTGGCTAAACACACCTCTGCACTGTGTAACAGCTGTCGCCTGGCTTCTGCCCGTACCACCAATCCTACTGCCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xian Tang et al.
Reproductive biology and endocrinology : RB&E, 19(1), 42-42 (2021-03-23)
Endometriosis is a disease that involves active cell invasion and migration. Talin-1 can promote cell invasion, migration and adhension in various cancer cells, but its role in endometriosis has not been investigated. This study was to investigate the expression level
Shihao You et al.
Cancer management and research, 12, 11309-11320 (2020-11-17)
Tanshinone IIA (TIIA) is one of the active constituents derived from the rhizome of Danshen, a traditional Chinese herbal. Recently, microRNAs (miRNAs) have been suggested to be associated with the anticancer role of TIIA. However, it remains vague of the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service