Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCTGTCTCGATGCACACACTGGTATATCCCATGAAGACCTCATCCAGAACTTCCTGAATGCTGGCAGCTTTCCTGAGATCCAGGGCTTTCTGCAGCTGCGGGGTTCAGGACGGAAGCTTTGGAAACGCTTTTTCTGCTTCTTGCGCCGATCTGGCCTCTATTACTCCACCAAGGGCACCTCTAAGGATCCGAGGCACCTGCAGTACGTGGCAGATGTGAACGAGTCCAACGTGTACGTGGTGACGCAGGGCCGCAAGCTCTACGGGATGCCCACTGACTTCGGTTTCTGTGTCAAGCCCAACAAGCTTCGAAATGGCCACAAGGGGCTTCGGATCTTCTGCAGTGAAGATGAGCAGAGCCGCACCTGCTGGCTGGCTGCCTTCCGCCTCTTCAAGTACG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GRB7(2886)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hong-Bing Zhao et al.
Pathology, research and practice, 213(9), 1180-1184 (2017-08-07)
Growth factor receptor bound protein-7 (Grb7) is a multi-domain adaptor protein that is co-opted by numerous tyrosine kinases involved in various cellular signaling. The objective of this study was to investigate the expression of Grb7 and its clinicopathological significance in
Jovana R Gotovac et al.
The Journal of pathology, 252(3), 317-329 (2020-08-02)
Efficacious therapeutic approaches are urgently needed to improve outcomes in patients with oesophageal adenocarcinoma (OAC). However, oncogenic drivers amenable to targeted therapy are limited and their functional characterisation is essential. Among few targeted therapies available, anti-human epidermal growth factor receptor
Kangmei Chen et al.
Theranostics, 8(2), 423-436 (2018-01-02)
Human growth factor receptor-bound protein-7 (GRB7) is a pivotal mediator involved in receptor tyrosine kinase signaling and governing diverse cellular processes. Aberrant upregulation of GRB7 is frequently associated with the progression of human cancers. However, the molecular mechanisms leading to
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU088051-50UG | 04061828397433 |
| EHU088051-20UG | 04061828623211 |