Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCCTCTTCATTTGGCTATGATGTGGCGGTGGTGGACCTCAACAAGGATGGGTGGCAAGATATAGTTATTGGAGCCCCACAGTATTTTGATAGAGATGGAGAAGTTGGAGGTGCAGTGTATGTCTACATGAACCAGCAAGGCAGATGGAATAATGTGAAGCCAATTCGTCTTAATGGAACCAAAGATTCTATGTTTGGCATTGCAGTAAAAAATATTGGAGATATTAATCAAGATGGCTACCCAGATATTGCAGTTGGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGGAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ITGA6(3655)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chunbo He et al.
Cell reports, 26(10), 2636-2650 (2019-03-07)
HPV infections are common in healthy women and only rarely cause cervical cancer, suggesting that individual genetic susceptibility may play a critical role in the establishment of persistent HPV infection and the development of cervical cancer. Here, we provide convincing in vitro
Daiane Cristina F Golbert et al.
Cell adhesion & migration, 12(2), 152-167 (2017-05-12)
The thymus supports differentiation of T cell precursors. This process requires relocation of developing thymocytes throughout multiple microenvironments of the organ, mainly with thymic epithelial cells (TEC), which control intrathymic T cell differentiation influencing the formation and maintenance of the
Nan Liu et al.
Nature, 568(7752), 344-350 (2019-04-05)
Stem cells underlie tissue homeostasis, but their dynamics during ageing-and the relevance of these dynamics to organ ageing-remain unknown. Here we report that the expression of the hemidesmosome component collagen XVII (COL17A1) by epidermal stem cells fluctuates physiologically through genomic/oxidative
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU088861-20UG | 04061831355253 |
| EHU088861-50UG | 04061828398225 |