Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGAGAGAACAGAATGTCAAGAATCAGGACTTGTTGCAGCAGGAAATCGAAGACTGGAGTAAATTACATGCTGAGCTCAGTGAGCAAATCAAATCATTTGAGAAGTCTCAGAAAGATTTGGAAGTAGCTCTTACTCACAAGGATGATAATATTAATGCTTTGACTAACTGCATTACACAGTTGAATCTGTTAGAGTGTGAATCTGAATCTGAGGGTCAAAATAAAGGTGGAAATGATTCAGATGAATTAGCAAATGGAGAAGTGGGAGGTGACCGGAATGAGAAGATGAAAAATCAAATTAAGCAGATGATGGATGTCTCTCGGACACAGACTGCAATATCGGTAGTTGAAGAGGATCTAAAGCTTTTACAGCTTAAGCTAAGAGCCTCCGTGTCCACTA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MIA3(375056)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jessica L Maiers et al.
Hepatology (Baltimore, Md.), 65(3), 983-998 (2017-01-01)
Fibrogenesis encompasses the deposition of matrix proteins, such as collagen I, by hepatic stellate cells (HSCs) that culminates in cirrhosis. Fibrogenic signals drive transcription of procollagen I, which enters the endoplasmic reticulum (ER), is trafficked through the secretory pathway, and
Yabo Li et al.
Journal of the American Heart Association, 9(7), e014146-e014146 (2020-04-03)
Background Epistasis describes how gene-gene interactions affect phenotypes, and could have a profound impact on human diseases such as coronary artery disease (CAD). The goal of this study was to identify gene-gene interactions in CAD using an easily generalizable multi-stage
Joan Chang et al.
Nature cell biology, 22(1), 74-86 (2020-01-08)
Collagen is the most abundant secreted protein in vertebrates and persists throughout life without renewal. The permanency of collagen networks contrasts with both the continued synthesis of collagen throughout adulthood and the conventional transcriptional/translational homeostatic mechanisms that replace damaged proteins
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU089831-20UG | 04061828595143 |
| EHU089831-50UG | 04061828359653 |