Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCACCACTGGAATGAAATCTATTACTTTGTGGAACAGTTGGCTCACAAATTCATCAGCCCACAGTTGAGAATGTCCTTTATTGTTTTCTCCACCCGAGGAACAACCTTAATGAAACTGACAGAAGACAGAGAACAAATCCGTCAAGGCCTAGAAGAACTCCAGAAAGTTCTGCCAGGAGGAGACACTTACATGCATGAAGGATTTGAAAGGGCCAGTGAGCAGATTTATTATGAAAACAGACAAGGGTACAGGACAGCCAGCGTCATCATTGCTTTGACTGATGGAGAACTCCATGAAGATCTCTTTTTCTATTCAGAGAGGGAGGCTAATAGGTCTCGAGATCTTGGTGCAATTGTTTACTGTGTTGGTGTGAAAGATTTCAATGAGACACAGCTGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ANTXR1(84168)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Cai-Xia Wang et al.
American journal of translational research, 12(7), 3557-3576 (2020-08-11)
Tumor endothelial cell marker 8 (TEM8) is a type I transmembrane protein, that has been widely studied in the areas of anthrax toxin infection and tumor angiogenesis. However, the role of TEM8 in the progression of epithelial ovarian cancer (EOC)
Amit Kumar et al.
PloS one, 9(6), e100228-e100228 (2014-06-28)
The Kaposi's sarcoma-associated herpesvirus infects the human population and maintains latency stage of viral life cycle in a variety of cell types including cells of epithelial, mesenchymal and endothelial origin. The establishment of latent infection by KSHV requires the expression
Maude Gabriel et al.
BMC cancer, 15, 227-227 (2015-04-18)
Modification of splicing by chemotherapeutic drugs has usually been evaluated on a limited number of pre-mRNAs selected for their recognized or potential importance in cell proliferation or apoptosis. However, the pathways linking splicing alterations to the efficiency of cancer therapy
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU092161-20UG | 04061828596867 |
| EHU092161-50UG | 04061828361854 |